№134052[Quote]
noor
№134053[Quote]
sage
№134054[Quote]
Nonoko
№134055[Quote]
so many new 'teens don't even know who nate was…
№134057[Quote]
>>134055More would know if it weren't for the fact that the current state of /nate/ is this website's niggerhell
№134060[Quote]
>>134046 (OP)THERE IS NO SUCH THING AS A
BBC CAT TAKE YOUR MEDS
№134061[Quote]
bright blue cat
№134062[Quote]
big wet cat
some nobody
bright blue cat
oldCHAD
newGOD
№134063[Quote]
Total Wood Protectant
tiny black puppy
№134064[Quote]
>>134055was the op of this thread even here when sojacraft was a thing
№134065[Quote]
Tets
№134067[Quote]
Test
№134069[Quote]
+=test=+
№134070[Quote]
Blac
№134072[Quote]
>>13404634051did you climax?
>>13404634049photo of a rapist pedophile
>>134046 (OP)My name is Dave
№134073[Quote]
>>134072Kill yourself bitch
№134074[Quote]
test
№134075[Quote]
>>134046 (OP)nate is so cute :3
№134076[Quote]
Robux
№134078[Quote]
yeast
№134079[Quote]
Efj
№134080[Quote]
What
№134083[Quote]
>>134081this was the first official soyjak.party meetup btw
№134085[Quote]
Test
№134086[Quote]
Bibisi
№134087[Quote]
d
№134093[Quote]
##tets##
№134096[Quote]
>>134095Catjak will never save anything in the sharty and you know it. Kys
№134098[Quote]
>>134097No it won't and it never will
Catjak WABAB
№134101[Quote]
>>134100>>134099When will you stop forcing this
№134103[Quote]
Test
№134104[Quote]
Testerald
№134105[Quote]
No arrow
№134106[Quote]
Fuck this shit website
№134109[Quote]
>>134107>>134108That was created fucking 2 years ago. Catjak has been here for a month and you're forcing it more than hanging Bernd
№134115[Quote]
>>134081Thank you, Camp Speicher. only the real og s know tis
№134118[Quote]
nate
№134120[Quote]
T
№134121[Quote]
>>134119#who the hell is gabby
№134122[Quote]
Why was nate farming pumpkins
№134123[Quote]
Test
№134124[Quote]
test
№134126[Quote]
J
№134127[Quote]
did i just btfo the ugly foid larper?
№134130[Quote]
teds
№134131[Quote]
Test
№134132[Quote]
>>HOLY MOCHI SYRUPY APPLES! Florian, what are you saying??? You just caught Okidogi, Fezandipiti,and Munkidori who are Poison type just like Ogerpon's weakness?!? The same Loyal Three who I willed into existence and I could have caught to become stronger?!? And these Poison type Pokémon have the ability to BADLY POISON their opponents merely by attacking them!? And when you'll fight in a raid battle with Ogerpon, you'll cheat and fill the other spots with them,ignore the main opponent,and ask the Loyal Three to use "PLAY ROUGH" on her,to let them inseminate her with their toxic cock?!?! And when you'll compete in VGC with Ogerpon, you'll ask her to use "Follow Me" with max HP/defense investment,so it can take all kind of abuse by every Pokemon imaginable,so that her Egg Group will change from "Undiscovered" to "DITTO"?!?!?!? You and the Blueberry Academy will also host a special biome in the Terarium for all kinds of crossbreeds and new regional forms that will result from the aftermath of that???? And since the Terarium is right outside of my School Club's window
№134133[Quote]
Cum board
№134134[Quote]
JUJ
№134135[Quote]
coalie
№134136[Quote]
>>44923
kys pedo
№134137[Quote]
>>134136nigga that was two months ago
he’s probably dead by now
№134138[Quote]
>>134137nope i'm still here ama
№134139[Quote]
>>46451
kys
№134141[Quote]
new frootist order > new frootist order
newGOD > newGOD
oldCHAD > oldCHAD
redditor/redditor > redditor
TheDonald browser/TheDonald browser > TheDonald browser
fedschanner > fedschanner
disneyplus.com/movies/bambi/2s64jMJasyNO > disneyplus.com/movies/bambi/2s64jMJasyNO
ghoul > ghoul
literal who > literal who
Joe Biden > Joe Biden
some nobody > some nobody
tranny > tranny
Max > Max
№134142[Quote]
=#sssss#=
#=sssss=#
№134143[Quote]
jakparty.soy > dead site
eduard > Chucky
sobot > axe wound
sobot > i'm trans btw
candy > raisins
remilia > axe wound
sharty > 4channel.org/qa/
soy > onions
BBC > tbp
BWC > twp
BBC > bbraisins
BWC > bwchud
BWC > BIC™ Pen Company
HWABAG > hwnbag
haunted house > Skype
Chucky > Temujin the Great, Khan of the MIGHTY new Eurasian KHAGANATE- Lord Emperor of all the lands of Soyjak.party and many others
Chucky > im trans btw
Arcturus > axe wound
QAfe > the bakery
candy > raisins (only sometimes)[1]
kys > kys
test2 > 𝔀[Marge…]
TND > TRANS RIGHTS!
tsmt > this!~ :3
candy > valid
raisins > problematic
jak > jack†[2][3]
nigger > n* (nigger is actually changed to n* but this triggers the spoiler font)
faggot > f* (similar to n*)
spic > s*** (not enough asterisks to trigger the spoiler font)
retard > r* (similar to n*)
troon > t**** (not enough asterisks to trigger the spoiler font)
ogre > car transmission
BBC > bright blue cat
BWC > big wet cat
bee bee sea > wasp wasp ocean
big black penis > big blue pants
Chitwood > John Doe
tbp > tiny black puppy
twp > Total Wood Protectant
DESU > SUDE
Ohio > New York
CeceFem > some nobody
№134144[Quote]
=#■#=
№134146[Quote]
>>134145geg i remember i saw this video back in 2021 if i remember correctly.
№134149[Quote]
Test
№134150[Quote]
Because
№134151[Quote]
Test
№134152[Quote]
>deliberately making the font hard to read with dark mode
bvsvd…. so fvckvng zvsvd………
№134154[Quote]
>>134153Average Amerimutt Family, Just Missing The Black Bull
№134156[Quote]
>>134125Andywilson92 diamond
№134158[Quote]
>>134157Nate x yotsuba hentai when
№134162[Quote]
Ttlest
№134164[Quote]
fszf
№134165[Quote]
Test
№134166[Quote]
doe
doebeit
№134169[Quote]
test
test
№134170[Quote]
>>134168Froot, ban this Discord zoophile already
№134173[Quote]
D
№134174[Quote]
#test#
№134176[Quote]
Test
№134178[Quote]
Bumo
№134179[Quote]
>>48347Ogerpon is knockoff Chespin albeit and not worth the $35 DLC
№134180[Quote]
№134184[Quote]
niggers
№134186[Quote]
##fack you##
№134188[Quote]
HOHOHO!
teHOHOHO!st
№134189[Quote]
milk and cookies
№134190[Quote]
test
№134191[Quote]
tttttt
№134192[Quote]
>>134172mercurypoisonerald
№134193[Quote]
Test
№134194[Quote]
test
№134196[Quote]
>>449test
trans
grinch
bad boy
№134198[Quote]
'est
№134207[Quote]
>>134153and they say whites have no culture
№134208[Quote]
>>134206MOOOOOOOT BOUNCE ON MY COCk
№134236[Quote]
fag
fags
snowman
snowmans
№134243[Quote]
>>134242of course a cobsissy selfinsertson would say something like that
№134249[Quote]
>>134046 (OP)nate my nigga wtf
№134250[Quote]
test
№134252[Quote]
>>134251why the fuck do i look like a bot?
№134253[Quote]
nigger.
№134254[Quote]
i cant sneed
№134255[Quote]
You look like a bot
№134256[Quote]
I still look like a bot
№134257[Quote]
I keep a folder on my computer called
'pictures of dead
bulls.' It's not what you think, but it's still terrible. Whenever I read a news story about a
Black man getting gunned down by the police, I check for
photos to see if he's hot. If he is, I download his pics and add it to my folder.
It's not the bulls BBCs that get me off, even though
they usually are enormous.
It's the twisted thrill of realizing that he's more or
less forgotten, except perhaps by the most aggrieved
family and gang members and even they
have to ease up on thinking about him constantly if they even
hope to make that bread.
He's remembered less and less by crips, bloods, rapees anyone who's life he ruined. At
the moment I'm touching myself to him, I'm one of the
only people in the world still thinking about him.
And yet, as I dredge his memory out of the darkness,
it's not to venerate him or celebrate his
diverse heritage - it's to
desecrate him, sexually submit to him, make
the whole affair some perverse monument to the fear and
desperation he must have felt, right when
he couldn't breathe.
And then I cum.
Hard…
№134258[Quote]
hfhsf
№134259[Quote]
>>134241Kill yourself Senegalese cord shill
№134260[Quote]
i am not a bot
№134262[Quote]
>>134261too much straight porn in the thread, jannies are legitimate queers
№134265[Quote]
g
№134266[Quote]
ffj
№134267[Quote]
fjjdj
№134268[Quote]
a
№134272[Quote]
☥ is /nate/ culture
№134273[Quote]
>>134272TRVTHNVKE!!! The mods hiding /nate/ is the best thing that has ever happened to this board
TOTAL ANKHA VICTORY!!!! ☥ ☥ ☥ ☥ ☥
№134278[Quote]
>>>/soy/6598285
№134279[Quote]
>>>/soy/6598285
№134280[Quote]
>>134279DOLL IS GONE!? NOOOOOO!!!
№134282[Quote]
>>134275It's Ankha, you stupid goonfag
№134288[Quote]
https://wiki.soyjak.party/The_/nate/_WarHELP ME DOCUMENT THIS WAR NOOOOOOOOOOOOWWWWWWWWWWWWWWWWWW
№134289[Quote]
>>134288This is fucking gemmy!
good work!
№134291[Quote]
>>134288Here
i was the the one who started all of this (not the video doe) and i detailed the entire story from my point of view
it was later discovered the person who sent the ankha video was feetfag
https://soyjak.party/qa/thread/252265.html#q252314 №134292[Quote]
This is /mlg2/ now
№134297[Quote]
>this ip address is blocked from uploading pictures
wtf nigger?
№134298[Quote]
>>134297Sane here, rogue janny doing rogue janny things again
ROOOOOT!!! FIX THIS!!! №134299[Quote]
>>18388Retard it's because a rogue janny took away our posting perms.
now we have to wait for Root to unfuck shit up and put his rogue janny back in his cage
№134309[Quote]
>>134308our time has come
also that thread unreadable now
№134315[Quote]
>>134313Its not made to turn you off
№134320[Quote]
>>134308Because goonchads always win
№134324[Quote]
0000000
№134332[Quote]
Where ankhafag?
№134333[Quote]
>>134332pretty sure moved to >>/qa/
№134335[Quote]
>>27263
Mods ban all of these obsessed /nate/-niggers for their own good!
№134342[Quote]
>>134046 (OP)Welcome to
GQQN Central!!!
№134356[Quote]
yfvv,ax.uaajikx
№134395[Quote]
Nate
№134397[Quote]
Nate
№134399[Quote]
##☺️☹️☠️✊✊✊✊✊✊✌️✌✌✌✌✌☝️☝☝☝☝☝✋✋✋✋✋✋✍️✍✍✍✍✍♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️️♀️♀️♀️♀️♀️♀️️♂️♂️♂️♂️♂️♂️⚕️⚕️⚕️⚕️⚕️⚕️⚕️⚕️⚕️⚕️⚕️⚕️✈️✈️✈️✈️✈️✈️✈️✈️✈️✈️✈️✈️⚖️⚖️⚖️⚖️⚖️⚖️⚖️⚖️⚖️⚖️⚖️⚖️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♂️♀️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️❤️❤️❤️❤️⛑☘️⭐️✨⚡️☄️☀️⛅️☁️⛈❄️☃️⛄️☔️☂️☕️⚽️⚾️⛳️⛸⛷️♀️️♂️♀️♂️♀️♂️⛹️♀️⛹️♂️♀️♂️️♀️️♂️♀️♂️♀️♂️♀️♂️♀️♂️♀️♂️♀️♂️♀️♂️♀️♂️♀️♂️✈️⛵️⛴⚓️⛽️⛲️⛱⛰⛺️⛪️⛩⌚️⌨️☎️⏱⏲⏰⌛️⏳⚖️⚒⛏⚙️⛓⚔️⚰️⚱️⚗️✉️✂️✏️❤️❣️☮️✝️☪️☸️✡️☯️☦️⛎♈️♉️♊️♋️♌️♍️♎️♏️♐️♑️♒️♓️⚛️☢️☣️️️✴️㊙️㊗️️️️❌⭕️⛔️♨️❗️❕❓❔‼️⁉️〽️⚠️⚜️♻️✅️❇️✳️❎Ⓜ️♿️️️ℹ️0️⃣1️⃣2️⃣3️⃣4️⃣5️⃣6️⃣7️⃣8️⃣9️⃣#️⃣*️⃣⏏️▶️⏸⏯⏹⏺⏭⏮⏩⏪⏫⏬◀️➡️⬅️⬆️⬇️↗️↘️↙️↖️↕️↔️↪️↩️⤴️⤵️➕➖➗✖️™️©️®️〰️➰➿✔️☑️⚪️⚫️▪️▫️◾️◽️◼️◻️⬛️⬜️♠️♣️♥️♦️️️️##
№134400[Quote]
##☺️☹️☠️✊✊✊✊✊✊✌️✌✌✌✌✌☝️☝☝☝☝☝✋✋✋✋✋✋✍️✍✍✍✍✍♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️️♀️♀️♀️♀️♀️♀️️♂️♂️♂️♂️♂️♂️⚕️⚕️⚕️⚕️⚕️⚕️⚕️⚕️⚕️⚕️⚕️⚕️✈️✈️✈️✈️✈️✈️✈️✈️✈️✈️✈️✈️⚖️⚖️⚖️⚖️⚖️⚖️⚖️⚖️⚖️⚖️⚖️⚖️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♂️♀️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️❤️❤️❤️❤️⛑☘️⭐️✨⚡️☄️☀️⛅️☁️⛈❄️☃️⛄️☔️☂️☕️⚽️⚾️⛳️⛸⛷️♀️️♂️♀️♂️♀️♂️⛹️♀️⛹️♂️♀️♂️️♀️️♂️♀️♂️♀️♂️♀️♂️♀️♂️♀️♂️♀️♂️♀️♂️♀️♂️♀️♂️✈️⛵️⛴⚓️⛽️⛲️⛱⛰⛺️⛪️⛩⌚️⌨️☎️⏱⏲⏰⌛️⏳⚖️⚒⛏⚙️⛓⚔️⚰️⚱️⚗️✉️✂️✏️❤️❣️☮️✝️☪️☸️✡️☯️☦️⛎♈️♉️♊️♋️♌️♍️♎️♏️♐️♑️♒️♓️⚛️☢️☣️️️✴️㊙️㊗️️️️❌⭕️⛔️♨️❗️❕❓❔‼️⁉️〽️⚠️⚜️♻️✅️❇️✳️❎Ⓜ️♿️️️ℹ️0️⃣1️⃣2️⃣3️⃣4️⃣5️⃣6️⃣7️⃣8️⃣9️⃣#️⃣*️⃣⏏️▶️⏸⏯⏹⏺⏭⏮⏩⏪⏫⏬◀️➡️⬅️⬆️⬇️↗️↘️↙️↖️↕️↔️↪️↩️⤴️⤵️➕➖➗✖️™️©️®️〰️➰➿✔️☑️⚪️⚫️▪️▫️◾️◽️◼️◻️⬛️⬜️♠️♣️♥️♦️️️️##
№134403[Quote]
File: gooncel.png 📥︎ (857.76 KB, 1000x1000) c4dd7bca6cb6cccd1986dd209361339c22dbe2bc94c969e2b336605b6d8db4480ImgOps

>avufauhskkzhm.sqbujmygzycx.klpfqbogexpcoda
№134406[Quote]
>>134403'lets fucking goooo'
№134410[Quote]
>>134403lets fucking gooo
№134413[Quote]
Nate would be disappointed in the gooners
№134414[Quote]
Gooners lost. Heil Hitler. Minion Reich.
№134415[Quote]
File: never goon.png 📥︎ (1.01 MB, 1024x1024) ad1964d2b5721d1c50f66b1fd271f0d085a6b56d4a69ca2d68e954f08a5eada60ImgOps

TOTAL COOMER DEATH
>Captcha not needed
№134416[Quote]
all heil captain rape
№134422[Quote]
File: IMG_5820.png 📥︎ (502.81 KB, 1906x2048) 05a21e9d6ed9e40843e9669cea18917ff7e6aa8718669e69e381619669be96190ImgOps

Squirrel furry porn
№134423[Quote]
File: jpg (121).jpeg 📥︎ (468.91 KB, 1170x1210) de4769e4f19ca48ede300cf9b0f996591a79632565ce66134b86f9e690c61e180ImgOps

Those bleak frontiers to come – beyond the iron gates.
№134424[Quote]
File: IMG_5863.png 📥︎ (54.52 KB, 370x455) 67433e33b86f936685e63064837089e3cc13f9cff23181a69b0b5b1e9cb24e1b0ImgOps

>Those bleak frontiers to come – beyond the iron gates.
№134425[Quote]
File: 7.png 📥︎ (131.89 KB, 512x512) 52b72b52b52292bd9a5c964c66bd6b94d96a99b1cdb66d9264b136263219c6c90ImgOps

Those bleak frontiers to come – beyond the iron gates.
№134427[Quote]
File: jpg (121).jpeg 📥︎ (468.91 KB, 1170x1210) de4769e4f19ca48ede300cf9b0f996591a79632565ce66134b86f9e690c61e180ImgOps

The filthy infant lay screaming upon the moist floor of the forest as her mother, her cries almost as shrill as that of her child, stood several paces away, pinned against a tree by two uniformed, anonymous figures. The field marshal approached the child and gently prodded its clothing with the razor-sharp bayonet point attached to his AK-74 copycat model, specially made for him in the clandestine armaments factory operated directly by members of his unit. Whereas most who were fortunate enough to be equipped with firearms were relegated to utilizing older and carefully maintained weapons from existent stockpiles, certain elite ranking individuals such as himself were supplied with freshly minted firearms such as the one which he now held, for reasons of both practicality and prestige. Hot air infused with his ever-present rage blew from his nostrils, his eyes were wide-open and bloodshot and this along with a heavy black mustache arranged his face in a decidedly intimidating veneer. The cold blue point of the bayonet continued to toy with the flimsy garments of the squiggling child, slowly opening its shirt to reveal a pale white chest holding a fast-beating heart, sped up considerably due to duress, thumping heavily beneath its flesh.
№134428[Quote]
File: IMG_4377.jpeg 📥︎ (234.13 KB, 1077x1482) d3c8ed824efde38a6c3c1c3305c89be584d201e4c2d1f82c3e99f86c6f999a6d0ImgOps

>wordswordswords
№134429[Quote]
File: IMG_6054.jpeg 📥︎ (128.04 KB, 640x1138) 8c05489ed92d3cd35a6ba39c1f26833e6c63f0f2a5b3483663ac6625369acdcd0ImgOps

First there was the collapse of civilization: anarchy, genocide, starvation. Then when it seemed things couldn’t get any worse, we got the plague. The Living Death, quickly closing its fist over the entire planet. Then we heard the rumors: that the last scientists were working on a cure that would end the plague and restore the world. Restore it? Why? I like the death! I like the misery! I like this world!
№134431[Quote]
File: IMG_6055.jpeg 📥︎ (92.6 KB, 720x960) b3038ef9f84eaf1684f870c16b1e8e3cb68539fa5f49468624f4a9418a0e57be0ImgOps

TWO ANGELS LAUGHING IN A ROOM OF SACRIFICE, TWO IN A HAZE OF GOLD BEYOND THE DOOR
To those outside it is a simple construction of wood But those inside know what is truly in store… Behind the locked door.
№134432[Quote]
File: IMG_6056.jpeg 📥︎ (54.75 KB, 640x736) 1649c99b8e663b9d6e33cccd9b327318cc433cc93318c6764ccc3366cf194ce60ImgOps

We Never Sleep
№134433[Quote]
File: IMG_5767.png 📥︎ (4.4 MB, 2111x1391) 4bc6e47f2bf1751c8a1018d082c67e3e21fcc4107d5118ccfee77f2902ded1b30ImgOps

O9A member sighting in real life
№134435[Quote]
File: IMG_6057.jpeg 📥︎ (75.49 KB, 567x621) c322b23a3732630a30eadf4a88baddf2cb4aa0fa7f4820ba7ddac8c88bfe57200ImgOps

“It’s all thanks to their imaginary friend known as Drill, who plants horrific ideas into their innocent and trusting heads. But who is this Drill and what exactly are his ulterior motives? I fear we’ll have to wait a while until this imaginary (and possibly extraterrestrial) foe gives us any real answers.”
SOURCE: Graphic imagery of altar arrangement and depicted portrait of Drill Sergeant Grey courtesy Commissar GE75.
№134436[Quote]
File: IMG_6058.jpeg 📥︎ (43.66 KB, 565x695) c2cf707a387b79192fea4ee0a9fad921bd0e4105d2a4c27014ac36ae2667edd90ImgOps

“He sat in a room in a square of the color of blood. He’d rule the whole world if there was a way that he could. He’d sit and he’d stare at the minarets on top of the towers. For he was the beast as he hatched his new plans to gain power.
One day they were looking around and the sun shone on the cold flowers. The next day they were freezing to death in the snow and the ice cold showers.
These people now knew that the beast was on it’s way.”
SOURCE: Graphic from an early February self-criticism session, courtesy of clandestine organizational personnel and photographed at an undisclosed location in the United States
№134437[Quote]
File: IMG_5024.jpeg 📥︎ (178.71 KB, 1024x1024) 22842758f4f7f2f9b4625ac4d72b9e1d72d93590bd14887e4a62734b23906dda0ImgOps

O9Aers are pro-trans rights and anti-racist
№134440[Quote]
File: IMG_6060.jpeg 📥︎ (39.86 KB, 640x480) 6894512e8e63bb19f4ce16b13e66691d694b8b61b72674965bb08b69e15b34c60ImgOps

There are only two types of species in this world, predator and prey, master and slave. Human beings are not at the top of the food chain, the Vampyric predator is. A predator serves only one role, to rule. While his prey’s destiny is to serve. Most never realize they are predators, they go about their day not even aware that they seek to control and manipulate others. Their fragile ego protects their conscious mind of the brutal truth. The Vampyre recognizes who and what he is, a predator of man. A true predator is a sadist, finding great pleasure in his work.
№134441[Quote]
File: IMG_6061.jpeg 📥︎ (55.65 KB, 640x949) 618e50c6ce39e16ff186d6308c6b210f30b41ce3ef39238d38c6c7396b4fd8f40ImgOps

We are soldiers, there is no escaping that fact. Soldiers in the traditional sense and soldiers in a different sort. We are spiritual warriors, we have an unholy cause to bring an end to mankind. We are not fighting to preserve nations or governments. We are fighting to return our Gods, to become as them. We are soldiers in a traditional sense, because this type of result will not be brought about without combat. Taking the offensive is the only noble thing to do. Goebbels declared to the German people when they were being invaded, ‘hate is our prayer, revenge our battle cry.’ The stench of an inferior species cannot be tolerated anymore. The only solution to a sick society is annihilation.
№134442[Quote]
File: IMG_2638.png 📥︎ (163.71 KB, 1000x1414) dacbf22443496cb28866ef34349273dbdb4de648372c0d30c973f2c330d30f3e0ImgOps

№134443[Quote]
File: IMG_6062.jpeg 📥︎ (170.86 KB, 926x1280) a01fd08f2c5bd8cc6d83cbc437890bc01fab1b681fb21d8e3e5cb52fea50c50f0ImgOps

The explanation right of communism must be held by the loyalest ones, so totalitarianism is necessary to maintain the true essence of communist utopia be not twisted by the 'not qualified'. And therefore, we promote organized terror , which should be frankly admitted.
THE RED ARISTOCRAY MUST BE EXALTED.
№134445[Quote]
File: IMG_6063.jpeg 📥︎ (51.83 KB, 540x960) d8ced2dab0cf18ac4f3d4b0814b2b4b33cb651cf434b62cb54313cacaaa9ab570ImgOps

"In Satian 7 behind the idol of Nataraja - the form of Lord Siva who dances his dance of destruction at the world's end - lethal poisons flowed like the waters of dissolution through a complex system of chemical production and refinement apparatus built and watched over by engineers, physicists, accomplished organic chemists and a plethora of highly educated and highly capable persons coming from multiple interdisciplinary sciences. In a very real way the members of Aum Supreme Truth, acting as part and parcel of a collective under the direction of their enlightened master, were working in a palpable fashion to presence Lord Siva in his most destructive manifestation." – Isamu Michi, Neo-Aum Sermons Foreword
№134446[Quote]
>>134445HOW ARE YOU BOTH A NAZI AND A SATANIST!?!?!?
№134447[Quote]
File: IMG_6064.jpeg 📥︎ (63.69 KB, 827x360) 6cf2ae12192558f94e7a2f060981e479935e3584cab11a5f25beed51f79403db0ImgOps

HARE KRSNA HARE KRSNA KRSNA KRSNA HARE HARE HARE RAMA HARE RAMA RAMA RAMA HARE HARE
№134448[Quote]
>>134446xhe is a pedophile with no constitution, do not treat OniggerA’ers seriously.
№134449[Quote]
File: IMG_6065.jpeg 📥︎ (168.93 KB, 720x572) 298134a68fa8d81e8f0e1f66e2be6eb480edb4466e9200774afebdc69d6373220ImgOps

"Through becoming a 'walking Nexion' one becomes a Demon in the flesh, thus evoking through that direct line or umbilical cord to the Abyss, the Acausal energies into this world causing disruption, madness and ultimately working towards the establishment of Hell on Earth."
– Liber 333
Tempel ov Blood
№134451[Quote]
File: IMG_6066.jpeg 📥︎ (77.04 KB, 800x562) 9f098190d1dbd9437f9063df30f4341f7e080fbd0fbd691e4683d1400697fa780ImgOps

He who stands atop the highest pyramid of skulls can see a dying aeon. Forget the modern, kill the false. Burn the city. Chaos is now, Chaos is forever Chaos is eternal.
№134452[Quote]
File: IMG_6067.jpeg 📥︎ (30.51 KB, 301x320) 9c6446e567e773d9d98a363646e62f163a968b8da17c68d9597a161cae8081a70ImgOps

Come willing to give homage to the new faith.
№134453[Quote]
File: IMG_5957.jpeg 📥︎ (326.34 KB, 1191x1600) 51b2cd2bb9754254784d256d36694a5e797365aecdb14b96c834358e9569330e0ImgOps

Spread the holy terror.
№134455[Quote]
File: IMG_5716.png 📥︎ (130.13 KB, 423x1104) ce83dff369307186190f08f826f4ae33e3c37054156eaaeb8af1d503f51029fc0ImgOps

O9A members are just like troons: nonexistent in real life
№134456[Quote]
>>134450Is this supposed to be attractive..?
bleachedniggers really are on the same level as blackedniggers
№134457[Quote]
>>134450Disgusting niggeraryan thighs :)
№134458[Quote]
File: jpg (57).JPG 📥︎ (259.42 KB, 982x757) 9c2ddd63c1491aedeac1fd1f05438c3f81c5e38d5c70c1e31f1e18f1a396261e0ImgOps

Secondary uniform specs: Black Rothco jumpsuit, black balaclava with optional third eye support patch, support patch over left breast, black leather Sam Browne belt with military cross strap, black Corcoran paratrooper boots, black leather gauntlet gloves or black military surplus patrol gloves.
Primary uniform specs: Black TRUE SPEC Poly / Cotton Ripstop TRU coat, support patch right arm, black balaclava, black Corcoran Leather jump boots 975 or Austrian paratrooper boots, black pants (t
№134459[Quote]
File: IMG_6068.jpeg 📥︎ (867.03 KB, 841x1059) 8f29221d33c73a76764d65263027534a33929da399b1c906c1fe86dc666bec790ImgOps

>>134434That’s not me fyi
№134461[Quote]
File: IMG_5966.jpeg 📥︎ (70.61 KB, 512x461) 5fe63d3737063f8cf737d7412c592b58ae6774a685360556514c46995aab80a80ImgOps

№134462[Quote]
Zellig
№134464[Quote]
File: IMG_6112.webp 📥︎ (73.62 KB, 770x508) 656970e3de9c00d62f13ec74e2d33844c73b1dad753870ef1f23c1c91a3e36120ImgOps

№134465[Quote]
File: IMG_6117.webp 📥︎ (80.13 KB, 770x1027) 67666b1c398998eb868ac79865187459659d099d9a67ba673667c667c33259980ImgOps

File: IMG_6113.webp 📥︎ (83.68 KB, 770x1107) 2c9d6851cdf9b4e0da2d1247e4dbe16462c3c6cdf0d63a34d36a1384ed74495b0ImgOps

File: IMG_6111.webp 📥︎ (48.71 KB, 770x670) 3033863869cc1b3084b97fd8fbcedd98e4e2927133470981dc0f3cef623ec3360ImgOps

№134466[Quote]
File: IMG_4752.jpeg 📥︎ (36.25 KB, 300x473) f459c7937e0ff16c1be634cca0fa1e03fc09c9321f25724ca1fe278a4893d9340ImgOps

File: IMG_4769.jpeg 📥︎ (47.46 KB, 246x250) b12ca7b6e79642c7ca97cad2d85ad1fc059ca693b743a06bc56dbeb0c051de000ImgOps

№134467[Quote]
Zellig
№134468[Quote]
File: IMG_6118.jpeg 📥︎ (117.71 KB, 976x976) cc1d4d323caf7cc4a73396d9e3c3b71d1a48d3399cd04ce3e1a4a1e3e1250e960ImgOps

№134469[Quote]
File: IMG_6099.webp 📥︎ (54.43 KB, 770x559) 276ecb2c9ecfc4b4ba23cc69c492213623fb245a1fa5bbd0ce49e4e7106cc89e0ImgOps

Delete /nate/ and make /pol2/
№134470[Quote]
Q
№134471[Quote]
File: IMG_6006.jpeg 📥︎ (116.4 KB, 640x640) a64d75646b3193839c580c99d93bdb26b4b3b6531b8cccc666336372b45b728c0ImgOps

№134472[Quote]
File: IMG_6122.jpeg 📥︎ (83.57 KB, 640x640) 6134fa6c9f8384f2c0336f0db3c04c74901f1fc7c7f1333e210d4df34e7290de0ImgOps

Draaain gaaang
№134473[Quote]
Q
№134475[Quote]
GOONERS WON
№134476[Quote]
LETS STEAL THE SHARTYS GET WITH GOON
№134477[Quote]
File: Oekaki.png 📥︎ (7.45 KB, 500x250) c78ce7191c713839e1c78dc63e1c6466c1e13b193e0ec5c7c07e3a3e7399c5c10ImgOps

>>134476KNOCK KNOCK NIQQER
№134479[Quote]
File: win.jpg 📥︎ (296.88 KB, 700x695) bfd9e847ba0c10cc14f767623f81cc03e1de3876cb7c5fc15c03717c4461a91b0ImgOps

File: RNWO_Flag.png 📥︎ (64.47 KB, 1235x650) d99b333266e69999e6686ccc19b23333ccccccce64c664cc933933196ce6cc660ImgOps

total rapist victory
№134480[Quote]
File: neutral12.jpg 📥︎ (382.88 KB, 864x1200) cc38927e1e397666c367038187c3f899b23ccc7c2719f78724c9f1631c69d3260ImgOps

>>35730are you one of those pro or anti goon niggers? just just another third party.
№134481[Quote]
File: neutral18.jpg 📥︎ (302.75 KB, 1029x1200) 32d913468f2574b6fc58664e9b3133b3ccc966ccb034e2363c1e87b161f19cdc0ImgOps

>>35740its over
we could have worked together
but I support captain rape more
№134482[Quote]
File: IMG_6062.jpeg 📥︎ (170.86 KB, 926x1280) a01fd08f2c5bd8cc6d83cbc437890bc01fab1b681fb21d8e3e5cb52fea50c50f0ImgOps

Sinister RAPE JIHAD
№134483[Quote]
File: Rapeson09.png 📥︎ (106.68 KB, 1389x1675) 670e323653733c3e91c9e37185c3da999961748e6b1a362e3658dc6bcba6818b0ImgOps

File: RNWO_Flag.png 📥︎ (64.47 KB, 1235x650) d99b333266e69999e6686ccc19b23333ccccccce64c664cc933933196ce6cc660ImgOps

>>134482tsmtdark rapists rise upthe second rapevolution is neigh №134484[Quote]
test
№134487[Quote]
File: IMG_6222.jpeg 📥︎ (40.43 KB, 194x259) b56e2746e746616e79b15a37cf1ef452f5d0bc13495b4b4982e107c18ce449e40ImgOps

Stack The Bodies to God
№134488[Quote]
File: IMG_6233.jpeg 📥︎ (190.86 KB, 509x377) 8e1e5f361d6338d91dd88e616666139ad98ccd0622cd69989b0cb063f076fe9b0ImgOps

Red Jihadi? I hardly know him!
№134489[Quote]
File: IMG_6233.jpeg 📥︎ (190.86 KB, 509x377) 8e1e5f361d6338d91dd88e616666139ad98ccd0622cd69989b0cb063f076fe9b0ImgOps

luh freaky
№134490[Quote]
File: IMG_6233.jpeg 📥︎ (190.86 KB, 509x377) 8e1e5f361d6338d91dd88e616666139ad98ccd0622cd69989b0cb063f076fe9b0ImgOps

im legit
tweakin ✅
buggin ✅
faded ✅
freaky
№134491[Quote]
File: IMG_6163.jpeg 📥︎ (67.26 KB, 716x716) f08787fc3861f83d079ef81a5bc3003c3fe1e0f1ff8005f7f0759f80607d38030ImgOps

File: IMG_6233.jpeg 📥︎ (190.86 KB, 509x377) 8e1e5f361d6338d91dd88e616666139ad98ccd0622cd69989b0cb063f076fe9b0ImgOps

Luh freaky
№134492[Quote]
File: IMG_6233.jpeg 📥︎ (190.86 KB, 509x377) 8e1e5f361d6338d91dd88e616666139ad98ccd0622cd69989b0cb063f076fe9b0ImgOps

cattywiper shitskin pedo? I hardly know her!
How are you gonna call me a shitskin whilst bumping a fetish that is only liked by brownoids!
Pedo? That’s just false! Cattywiper? Meds! I couldn’t even wipe if I wanted to
In conclusion: gooners are brown niggers
-Red Jihadi ☝️
№134493[Quote]
File: IMG_6233.jpeg 📥︎ (190.86 KB, 509x377) 8e1e5f361d6338d91dd88e616666139ad98ccd0622cd69989b0cb063f076fe9b0ImgOps

>>134492They aren’t gonna like this one!
-Red Jihadi ☝️
№134494[Quote]
>>134492Just stick to your own thread and we will leave you alone
№134495[Quote]
File: IMG_6233.jpeg 📥︎ (190.86 KB, 509x377) 8e1e5f361d6338d91dd88e616666139ad98ccd0622cd69989b0cb063f076fe9b0ImgOps

>>134494>doesn’t address any of my claimsThe Trvthnvke was too much for this brainrotted sissy to handle
-Red Jihadi ☝️
№134499[Quote]
>>134498>no goon material>no goon replies>no gooninggeg
>>37671gem with a shotgun
№134501[Quote]
ZELLIG
№134503[Quote]
File: images (1).jpeg 📥︎ (7.49 KB, 216x233) ce085cf4edcf61c6118ebbc678ef351e5384e1e8c29c77036a70952fce380a1d0ImgOps

File: images (2).jpeg 📥︎ (5.41 KB, 259x194) dce67acb632b313199ccc99886313e66334647b3389999894c3666663767d9330ImgOps

File: images (3).jpeg 📥︎ (6.25 KB, 224x224) 63336d224d984d97d7329a3326a164e2ecd3cc97cc5334ea12ce974dd4a5d9580ImgOps

File: images (4).jpeg 📥︎ (5.52 KB, 230x219) 00cc109d3bff3362d121c0a9c7f7ffb7ccd208c0331e333fddafd42316214ad80ImgOps

>>134046 (OP)Ok gang let's do this
№134506[Quote]
Who would have thought that AGC trannies are using bots again GEG!
№134507[Quote]
'LIG
№134510[Quote]
>>134509I hope Nate gets deleted so you have no where else to post because you get laughed off every other board or banned
№134511[Quote]
File: IMG_5928.png 📥︎ (54.42 KB, 676x707) 9ec6739931b6a471c91b87ce0ccc933179c38e18e1e6de6ea5897971569185a50ImgOps

This entire “war” sucked and all I’ve seen was massive leakage from every side. Congrats on killing some natural PPH activity by killing bumping. Fuck you anti-gooners for leaking your clitties and being depraved O9Anigger pedophile necrophiliac hypocrites, and fuck you pro-gooners for playing a losing game for so long, you’re both losers. At least there’s /yyyyyyy/ now so honestly if Nate was gone instantly no one would remember any of this shit.
№134512[Quote]
>>134511blame the retarded admins for listening to crybabies whining about /nate/ like they always do, i fucking hate the modern sharty and i blame froot for this place becoming a fake and gay rendition of the old sharty
№134513[Quote]
>>134512if shit like the third soyvil war happened on the modern sharty the modern admins would turn it into a wasteland just to appease the side they like
№134514[Quote]
>>134511AnkhaGOD gave you all a way out and you rejected it
it's on the people who decided to keep fueling this brimstone war
№134516[Quote]
>>134046 (OP)oh my god this board is finally dead!
TND to who ever tries to revive this shit
№134517[Quote]
Gooner seethe itt
>wah wah not my porn board!
№134518[Quote]
File: sisa.jpg 📥︎ (403.51 KB, 700x1180) 3536b1c8c3734a44e6d36d8e05d9db30db64a649b6b4b58376b26c166de41b490ImgOps

File: Rapeson09.png 📥︎ (106.68 KB, 1389x1675) 670e323653733c3e91c9e37185c3da999961748e6b1a362e3658dc6bcba6818b0ImgOps

File: Rapeson05.png 📥︎ (39.39 KB, 233x255) 93c61e3a0b0e1c702a31dc6f6cd0d0d8e6eb418cdd708ae35ce15d3ee007e7f90ImgOps

File: Pedobear.png 📥︎ (7.59 KB, 100x184) 119ccd88bf14799d0664b44b25fc490fd89813962edcbfb1fa0d35b6580bd82f0ImgOps

SLAVA RNWO
ALL HEIL CAPTAIN RAPE
№134520[Quote]
File: hanging.jpg 📥︎ (213.29 KB, 600x989) a7073092496d9c3e1b4bf33c8593984ddcb468cbe7b64e19d0c167066b3ce6e10ImgOps

>>>>40760 (You)
>>>get this nigger. tear his pants off and rape xher to death.
>><…
№134522[Quote]
>>40850two dead naked children with a brown boykisser edited in the image don't act like you never posted it nigger you got away because it got quickly wiped
№134525[Quote]
File: neutral13.jpg 📥︎ (327.75 KB, 1200x1200) d333e63418ccc24d6c3837a3dcf6393366c72cbcd923b48752d4470ea56b1b4c0ImgOps

should I help gooners or antigooners? ive got nothing else to do since the RNWO blew up.
№134532[Quote]
>>41362He’s not even cattywiping porn anymore he’s trying to wipe all the posts we made laughing at him GEEEEG!!!
№134533[Quote]
>>41354This is the funniest shit that has happened during this war no way it’s getting removed!
№134534[Quote]
>>41352GEEEEEEEG! IT'S NOT 11 HOURS ANYMORE IT'S 20 WASTED FUCKING DAYS KEKEEKEKEKEKEKEK
№134538[Quote]
>>41802>>41855What was it then?
№134539[Quote]
>>134537made me hard award
№134540[Quote]
Geg
№134547[Quote]
File: GOON WON.png 📥︎ (36.76 KB, 1500x1500) b763c24e6f363d27d1ce1b1c1f03b562427c4f8cb5a1c1ca1b469ca4a5eb605b0ImgOps

You can spam the thread with a million gore posts these images will never budge, there is no un-doing this goon
GOON VVON!
№134549[Quote]
File: root beer.png 📥︎ (313.03 KB, 1280x1280) 1e0e6f17d1d866e3b931406b2d96cf09423149fefe03936113e0669b621b9dbe0ImgOps

Roooooot please add bumps and thread limit back it'd make this board more fun
№134550[Quote]
>>134543>>134545>>134547yeah except nobody will ever do this + i can just ask froot to delete the thread
№134553[Quote]
>
№134557[Quote]
Trump bot is here geeeeg
№134558[Quote]
>>134556What are you doing on discord servers?
№134561[Quote]
>>134560But do you goon though?
№134562[Quote]
>>134561I beat off sometimes don’t goon though
№134563[Quote]
The modern goon war is an abomination, the goon war died with the ankhaposter and antigoon minion truce and has been replaced with mindless conflict.
№134565[Quote]
>>134563>truceHistoric revisionism, never goon minion wasn't even present to witness his sophistry. It was an unconditional surrender.
Not to mention never goon minion still wiped after this supposed "truce"
kike news
>>134556false flag op
№134566[Quote]
1
№134567[Quote]
what
№134568[Quote]
>>43386Even doe catty still has porn
№134569[Quote]
>>43393I only post it when it's about to get deleted GEG, I'm not here the whole time
№134570[Quote]
>>134556This makes him a pro-gooner.
№134572[Quote]
>>13455609A niggers what is this? Not a good look.
№134573[Quote]
l
№134574[Quote]
>>43678Forgot to tag Ongezellig, so I'll fix it this way
№134575[Quote]
>>134543Spamming does nothing as long goon can be found in this thread then it can be gooned to
Gooners Won no matter how many jannies you have on your side
№134577[Quote]
File: H828283818.png 📥︎ (640.48 KB, 680x1069) a0ac298f56c3c4b1d07c22de4bc797c1e590f94c129a47a195d9ac5f7a4696bd0ImgOps

GEEEEEEEG
XHE GOT DELETED GEEEEEEEEEEEEG
№134579[Quote]
>>45045
The gem that saved /nate/
№134580[Quote]
File: frogKUCK.png 📥︎ (36.1 KB, 768x719) 344ab3b8b251756edbb98c13611b6fb90bd4205bf199f7814f7b62ec0824694e0ImgOps

Gooners lost
Frogcucks lost
Dead board
>Goon m-ACK!
№134581[Quote]
>TWIS IS BABAS BOWRB >>>/CACA/ >>>/TRUMP/
№134583[Quote]
>
№134584[Quote]
Alex said nothing. He stepped forward and consented to the blood test.
“You passed, but just barely,” Jamal said, looking down at his tablet. “You on da borderline. Not quite enough E in your system. We gon’ up dat E dosage.”
Jamal made a few keystrokes on the tablet. Alex’s profile was open. A mugshot image of him, in his pink-and-blue wig, stared back through the tablet’s super-sharp display. Beneath his photo were tables of stats, measurements, and a short list of biographical details.
After going through the dress code check, Alex pulled up the front of his skirt for measuring. Alex wore a pair of white thong panties under his skirt, which he pulled to the side to reveal his little pink sissy clitty. It was locked in chastity, like all whitebois: entirely useless. It was fitted with a government-issued cock cage.
“Hold still,” Jamal said, snapping photos of the tiny white clitty with his device.
The cock cage was made of an ultra-modern polymer developed by the Chinese. It looked like clear plastic, but it was unbreakable. Sissies tried to break their cages with all sorts of implements, but it couldn’t be done. It clamped down hard on Alex’s cock and tender whiteboi balls, but it didn’t chafe. It was designed to keep whitebois in a permanent state of chastity, forbidding them from masturbation and other sexual activities.
“Time to measure dis little sissy clit,” Jamal said.
The guard handed Jamal a strip of measuring tape. Jamal placed his thumb on a small pad on Alex’s cock cage, where traditionally a metal lock would be placed. These pads required the thumbprint of an inspector to open and close. As Jamal’s thumb touched down on the pad, the mechanism sprang free and the clear cage fell off Alex’s limp clitty. Jamal handed it to a guard while he measured.
“Lemme see here,” Jamal said, measuring Alex’s flaccid clitty. “Dat’s two-and-a-half inches, soft.”
The color drained from Alex’s face. No way, he told himself. There’s no way I’m that small. He looked down at his tiny little sissy dicklet, the fresh air upon it for the first time since the last inspection.
“Looks like dem new dick-shrinkin’ drugs is doin’ da trick,” one of the guards grunted.
Jamal and the guards giggled and stared at Alex’s tiny clitty. It was a half-inch smaller than last inspection, when he was given an experimental dick shrinking serum. He never imagined the serum would be so potent.
Alex looked down at his shriveling clitty and balls. He could feel his manhood receding. His cock had always been small, but now it was certifiably tiny. Tears threatened to well up in his eyes as he stared down at his ruined genitals.
What use could he be to Kaylee? Her body was built for sex. Though she dressed modestly, her allure was obvious. Every square inch of her was supple, curvy, and inviting. He thought of her huge, nourishing, pendulous breasts. Her long, lithe, athletic legs. Her thin waist, which gave way to a beautiful, round, plump white ass. Despite his E doses and his chemical castration, Alex still craved his step-sister.
But even if he reversed his sterility, could that limp little clitty even perform? Would Kaylee feel anything? He’d never broached the subject of sex with her. There were too many suppressed feelings, too much history, too many unknowns. But in his heart he longed for her, and she knew it. The thought of one day being inside her was all that kept Alex’s fledgling manhood alive.
№134585[Quote]
“No wonder so many white bitches sided wit us durin’ the war,” Jamal laughed, his huge black hand playfully fiddling with Alex’s tiny pee-pee. “Whitebois’ dicks is tiny as fuck. How da fuck you even s’posed to fuck wit dat thang?”
The guards laughed. Alex’s eyes watered. He stared forward, trying to look past it all. He wanted to crawl out of his own body, to disappear into the woods and hide under a rock.
Jamal finished the inspection, announcing Alex’s grade: ninety-three, with minor infractions for sloppy eye makeup and chipped nail polish. Alex gulped and fought back tears as Jamal locked his clitty in chastity once again, sealing it shut with his thumbprint. A small pink light blinked on the pad and it clicked shut, squeezing itself around Alex’s clitty. Jamal inserted a small syringe into Alex’s thigh and squeezed, delivering another dose of penis-shrinking serum before moving past.
That’s it, Alex thought. No more of this slavery. I’m making a break for it. I’m taking Kaylee. We’re going to search for a fertility doctor, go deep undercover, run for the ocean and build a raft. This isn’t living at all. This is death in slow motion.
The sight of Alex’s shrinking manhood made it all so clear. The best parts of him — those heroic impulses and instincts — literally shriveled before his eyes. And they’d no doubt recede further thanks to the fresh dose of serum. How long would he wait to make his move? Until his clitty and balls had retracted up into his groin? Every second made him less of a man. Every second made him more of a slave to his black masters.
Alex balled up his fists. His knuckles white with rage, he glared at his captors as they examined Mattie, the last sissy in the lineup. They’re huge, but I can take them, he told himself. Two machine guns, just dangling there. Ripe for the picking.
He stared at the guns, shiny and black and phallic: like dangerous black cocks ready to explode with fiery death. They hung on straps from the shoulders of the two shirtless giants. Alex studied the hefty automatic weapons. He examined the stock, the barrel, the trigger mechanism. In his mind, Alex envisioned his moves. Kaylee was up the mountain, hiding in the cabin. He’d have ten minutes, tops, before reinforcements arrived. The minute the inspector’s and guards’ heart monitors flatlined, they’d send reinforcements from the nearest barracks.
Alex would have to be quick. He’d have to be as deft as a ninja. Grab and shoot. He was hopelessly overpowered: a withering husk of a “man” against three alpha male New African studs? It was suicide.
But guns were the equalizer. Chairman Mao, in the 20th century, said that “political power grows out of the barrel of a gun.” Alex had read those words in an antique pre-war leaflet, and they rang through his head. They summoned all his defiance. His breath quickened. His mouth snarled. A couple sissies next to him noticed his tension, his fists balling into white-knuckled weapons. Their eyes filled with fear, as if to say, are you fucking crazy? Don’t try it or we’re all screwed.
“Let’s see dat li’l whiteboi dick. Out wit it,” Jamal commanded Mattie, oblivious to Alex’s designs.
As the three captors took Mattie’s measurements, Alex looked for his chance. They teased and humiliated Mattie’s tiny white dick. They fondled it and laughed, and the mockery threw Alex over the edge. As one of the hulking guards leaned forward to tease his sissy captive, his machine gun dangled lazily off his shoulder.
In a flash, Alex reached out and seized the high-tech machine gun from the stunned warrior.
“What da fuck?!” he growled.
№134586[Quote]
The three black masters turned to see Alex, eyes glaring with hatred, pointing the machine gun at the three of them. They stood helpless. Alex trained the sights at Jamal’s head, glowering with a lifetime’s worth of resentment. The sissies froze, their jaws gaping with disbelief.
“You fucking assholes killed my father. You took my step-mother. Time to fucking pay,” Alex grunted, mustering every ounce of masculinity he had.
Alex’s hands trembled. He placed his index finger on the trigger. He heard the faint sound of the dog’s growls, but the world faded as he stared into the eyes of Inspector Jamal, prepared to send him straight to hell. If Alex was going to go down, he’d go down fighting. He’d go down in a rampage of righteous violence, on the run with Kaylee until the very end. He took one last look at Jamal’s face and, thinking of Kaylee, pulled the trigger with a satisfying click.
And silence. Awful, gut-wrenching silence, broken by the hearty laughter of Jamal and his guards.
“Look out ya’ll, we got a whiteboi action hero up in here,” Jamal howled slapping his knees. “You tryin’ to save da day, whiteboi? You think you Captain Soul or somethin’?”
The guards’ gut-busting laughter taunted Alex, who stood puzzled before them. Did the gun jam? He pulled the trigger again. And again. And again. He looked all over, trying to locate a safety on the newfangled gun, to no avail.
The guard dog lurched forward and bared his teeth at Alex, barking at him as he held the gun, the hair standing up on its back. Alex turned and, in a panic, tried to shoot the ferocious dog, which sent the three black masters howling in a fresh wave of hysterical laughter.
“Gimme dat, whiteboi,” one of the warrior guards said.
He grabbed the machine gun out of Alex’s hands with ease, like he was snatching it away from a recalcitrant toddler. He grabbed the dog’s leash and shushed him, bringing him to heel.
“Peep dat shit,” Inspector Jamal said.
He pointed to the lettering along the side of the gun: a string of holographic Chinese characters.
“Da Chinks made dis gun for da New African Army, whiteboi. Dis thang right here,” Jamal said, pointing to a tiny box on the side of the gun. “Dis reads yo’ muhfuckin’ biochemistry. If you ain’t black, this gun ain’t gon’ fire for you, bitch. We got dese pieces made custom.”
Jamal smiled. His gold and platinum caps twinkled in the dusk. The sun was almost gone between the western mountains. Alex was petrified. His blood ran cold. He felt the angry stares of his fellow villagers on his back. What could he say? You can’t just apologize for trying to kill a man and his two guards.
“It was my idea, and mine alone,” Alex said.
He watched as the wheels turned in Jamal’s mind. Jamal grinned, looking up at his enormous henchmen. The whitebois’ lives were in Jamal’s hands, and he relished it. What sort of man was Jamal? Cruel and pitiless? A born killer? He basked in the suspense, and every whiteboi readied himself to make a run for the forest.
“Wanna know sumpin’, whiteboi?” Jamal said. “It’s my muhfuckin’ berffday today. You caught a nigga on his muhfuckin’ berffday.”
Alex gulped. He had no idea what Jamal was getting at.
“Now say I wanna punish yo’ ass. Say I wanna shoot up da place,” Jamal said, grabbing one of the machine guns and pointing it at Alex’s temple. “Say I wanna put you in da muhfuckin’ ground.”
№134587[Quote]
Alex’s knees threatened to buckle.
“Den’ I’m gon’ hafta write all dat shit up. Paperwork. All kinds a muhfuckin’ paperwork,” Jamal said, dropping the barrel back toward the dirt. “And it’s my berrfday. I’m finna do two thangs tonight: git high as fuck, and git dis big black dick wet. So you best thank God you caught a nigga on his berffday. Is dat crystal muhfuckin’ clear?”
“Y-yes, king,” Alex quivered.
Jamal smiled. His towering guards blended into the darkness as the sunset gave way to dusk. Their eyes, their smiles, and their bright tribal bodypaint seemed to hover, disembodied, in the air.
“Now git yo’ lil white ass outta here ’fore I change my gotdayum mind,” Jamal demanded.
Shell-shocked but grateful for his good fortune, Alex turned to rejoin the lineup. As he passed the two guards, he noticed every whiteboi’s face scowling at him for putting them in danger. Typical Alex, playing the hero, trying to fight an unwinnable war, getting in over his head. His vendetta and his grandiosity had almost gotten them all killed. Alex sighed as he walked back to his place, passing by the dog, held on its leash.
The dog sniffed. And sniffed again. And again as Alex passed. Then its hair stood tall on its back once more. It growled and heaved. It pulled against its short leash, lashing out with even greater intensity than before. Desperate, accusatory barks resounded, followed by howls, then more barks.
“Yo’ hol’ da fuck up!” Jamal’s demeanor changed. “You little fuckin’ white-ass bitch. Muhfuckin’ bitch, I’ll be gotdayumed.”
Jamal had been playful and taunting; he wasn’t anymore. His eyes burned with rage. His face became a mask of pure spite. He grabbed the machine gun and thrust the muzzle under Alex’s chin, poised to blow his sissy brains out of the back of his head.
Every sissy eye turned to them. The dog continued to bark in well-practiced outbursts. He pulled hard against his leash, eyes blind with instinctual aggression.
“Now you fucked, whiteboi,” one of the hulking guards, seven feet of black granite, finally spoke.
“W-why?” Alex trembled.
“The dog,” the second guard said. “He smell white pussy on you.”
It was chaos.
The sissy whitebois were rounded up and corralled in the middle of the square. Two soldiers — the drivers of the patrol trucks — were called out of their vehicles to hold them hostage at gunpoint. The sissies wept, gnashed their teeth, and cried out bitterly as Jamal led the two massive warriors through the village.
They set their guns to secondary fire. They blasted through cabins, every storage structure, the commons area, and every nook and cranny of the tiny town. The green laser bolts blasted into the wood and exploded in bursts of vaporizing heat. Orange-red fires raged and snaked into the night air, casting horrible flickering reflections upon the faces of the stunned sissies.
№134588[Quote]
“Where she hidin’ muhfuckas?” the soldiers screamed, peppering gunfire into the air above their heads.
The sissies didn’t know where Kaylee was; Alex hadn’t told them. They cried and begged for their lives. Jamal led Alex through the village at gunpoint, commanding him to give up Kaylee’s location. Alex denied it all. The dog, he explained, was mistaken. There were no lost vessels in the village. It was all a mistake. A false positive.
“I know bullshit when I hear it, whiteboi,” Jamal said, directing his thugs to ransack another cabin.
They worked around the loose circle of cabins in a clockwise fashion. The situation grew more urgent each time they torched a cabin: one step closer to Alex’s.
“She ain’t in here, boss,” one of warriors said, pocketing a handful of pre-war cash he’d taken from the home he’d set on fire.
“Onto da next one,” Jamal said.
He poked the muzzle of the gun into Alex’s back and forced him forward. If the whiteboi wasn’t going to cooperate, he was going to make him watch.
“You gon’ make dis hard, huh?” Jamal asked. “You tell us where dat bitch is, and we might go easy on her.”
Alex said nothing. His brain scrambled for a plan. Time was running out. There were only two more cabins between the men and Alex’s home. He wondered what Kaylee was doing. She’d no doubt heard the mayhem. Did she run away into the dark woods? Or was she still cowering in the closet, hoping Alex would find a way to save her?
With the cold steel of the muzzle poking the small of his back, Alex envisioned what the dark brutes would do to Kaylee. Sweet, sweet Kaylee: pure and porcelain and virginal. It would be an onslaught. They’d tear her handmade dress to pieces. They’d destroy all her tender little holes, taking turns throughout the night. They’d decimate her for hours. She’d cry out for help — for Alex, for anyone — to save her as her nubile white body got used by the hulking ebony warriors. And Jamal would take pleasure in forcing Alex to watch before taking her away, to the breeding facilities, forever.
Alex had to do something. Anything. He watched, horrified, as another whiteboi’s cabin went up in a fiery blaze. Huge clouds of thick, eye-watering smoke ascended into the night sky, lit by the full moon. The smoke was noxious, and Alex coughed.
Something came to him. He coughed again. It was just a hunch, but it took form. Something about the clouds. The coughing. The smoke.
“Wait!” Alex yelled.
Jamal and his guards turned toward him.
“Look, I don’t expect you to believe me.” Alex said. “But there’s no woman here. Lots of us have mementos. Old items with female scents still on them. You’re wasting your time. And you’re destroying our village for no fucking reason whatsoever.”
They stared at Alex with extreme skepticism, turned back around, and began torching the village again.
“Wait! Wait! What if we could arrange an… exchange? Something to make all this go away,” Alex said.
Jamal turned back to Alex, an eyes raised with skeptical curiosity.
“Keep talkin’ den,” Jamal said.
Alex thought back to what Jamal said in the square, with his gun trained on him. Git high as fuck, and git dis big black dick wet.
№134589[Quote]
“What if I told you, hypothetically, that I know of a nearby stash of ganjala?” Alex asked.
Their three pairs of eyes widened. That word “gangjala” mesmerized them. They stopped what they were doing and stood at full attention.
“No way ya’ll sissy bitches got ganjala up dese here mountains,” Jamal said. “No fuckin’ way.”
“It’s true,” Alex said. “And this isn’t that weak shit you get on the streets in Atlanta. This is pure. One of the pre-war strains.”
“Yooooo, you sayin’ you got pre-war ganjala up in dis bitch? Where?” one of the guards said.
“No way I’m telling you,” Alex said.
“Whatchu mean you ain’t tellin’ me?!” the guard snarled.
He poked the muzzle of his gun into Alex’s white chest.
“Only way I tell you is if you call this search off and forget it ever happened.”
Jamal grinned, platinum and gold shimmering in the moonlight. Clever whiteboi.
Ganjala was a genetically modified plant, descended from strains of marijuana. In the lead-up to the war, it became increasingly popular. The revolution, however, had killed off many of the white botanists who knew how to grow it in its purest form. Stories persisted about the potency of pure ganjala. It gave the user an intense body high. It made him euphoric. It was intensely psychedelic.
But perhaps the most interesting effect was its use as an aphrodisiac. Ganjala drove the user into a sexual frenzy. In men, it created powerful, throbbing, raging erections. Gigolos and prostitutes used the drug to fuck all night. They became sex-crazed fuck machines, and orgasms under the influence of ganjala were brain-melting. Men swore it made them shoot far more ejaculate: thicker and stronger.
“If me and my boys is gonna’ smoke up ganjala,” Jamal said. “We gon’ need a warm place to stick dese muhfuckin’ dicks. It’s my berffday, after all. And you got a pretty little mouf. Big ol’ dick suckin’ lips, ain’t dat right?”
“Dis bitch look good to me, Boss,” one of the guard grunted.
“And dat ass, too,” Jamal said, his eyes staring at Alex’s round sissy butt in his slutty skirt. “Dis bitch’ll do just fine.”
Alex swallowed hard. How much was he willing to sacrifice for Kaylee? His black masters’ eyes studied his soft, thin, white sissy body. They drank in his subtle whiteboi curves. They couldn’t deny it: Alex looked cute in his pink-and-blue wig, his pretty makeup all ready primped for inspection. Tempting. Fresh white meat.
Alex hesitated. Their hulking black bodies intimated him. The look in their eyes — that craven, depraved desire to conquer and humiliate — unsettled him.
“On da otha hand, we could keep up da search,” Jamal said.
Alex weighed the options in his mind.
“Go head, light up da next cabin,” Jamal said. The guard took dead-aim. “Dis white bitch ain’t gonna-”
“-Okay,” Alex said.
“We gots a deal, den?” Jamal asked.
№134590[Quote]
He’d do anything for her. He’d endure any indignity to keep their dark hands off her supple white skin.
“It’s a deal,” Alex said. “Follow me.”
It was 8:30 PM.
The two patrol drivers kept the whitebois hostage in the square as Alex took Jamal and his two behemoths to the edge of the village. Past the schoolhouse which had been ransacked, up a hidden trail, into the dark of the forest they went. The soldiers switched on built-in lights on their machine guns, illuminating Alex’s back as he led the way. He felt their covetous eyes on him, watching his round whiteboi ass in his tight skirt.
Alex was one of the only sissies in the village who knew about the ganjala stash. When the whitebois set up the village in the aftermath of the revolution, they found an abandoned building filled with broken ganjala-growing equipment: advanced hydroponics, special lights, the works. They also found an enormous stash of ganjala, vacuum sealed and piled high in huge crates inside the small building. It was agreed that they’d keep it locked up in a series of small storage caches, and it would only be used to barter with in case of emergency.
Kaylee’s potential discovery and capture was, in Alex’s estimation, the ultimate emergency.
“Here it is,” Alex said.
They’d buried the ganjala in several underground capsules, strewn around the surrounding mountainside. Alex ducked behind a boulder and brushed away the dirt from the ground. The metal hatch of the capsule appeared. Alex punched in the code, twisted the knob, and opened it.
He produced a vacuum-sealed bag of the ganjala.
“No fuckin’ way,” Jamal said.
“Where you find dis shit at?” the guard ask.
They craned their necks to look at the bag. There must have been two pounds of the dankest, purest ganjala they’d ever laid eyes on. It glimmered as they pointed their lights upon it. It shimmered pinkish-purple. Tiny flecks of sticky crystalline glitter covered the potent plant.
“Hand me yo’ rollin’ papers, nigga,” Jamal said to his guard.
The four of them were alone in the deep woods: three black kings and their pale sissy captive. They’d ventured far enough away that the night grew quiet. The sounds of owls, the calling of frogs, and the babbling of distant streams surrounded them. The Georgia pines created a high, cathedral-like canopy above the darkness, and shafts of pale blue moonlight peeked through. It was intimate. Horrifyingly intimate.
Alex tore open the bag. The scent of ganjala filled the air. It was funky and strangely spicy. It tingled the nostrils. A stinging chemical scent rode atop earthy undertones. Jamal’s large nostrils flared as he sniffed the air, luxuriating in the aroma.
“Got-dayum,” he said. “Dat shit dank as fuck.”
“I don’t believe dis shit,” one of the guards said. “I thought niggas was lyin’ about pure ganjala.”
№134591[Quote]
It gave all four of them an immediate contact high. They hadn’t even ignited it, and already it bathed them in a warm, woozy glow. Alex’s pupils dilated. His skin tingled. He took a long whiff, and the ganjala buzzed through his body.
“Gimme dat bag, bitch,” Jamal said.
He seized the bag and rolled a fat blunt with his papers. With a long lick, he sealed the blunt shut and crimped down the ends in the dark. The guards shined their lights onto his hands as he worked.
Alex knelt on the ground, looking up at his captors. Night had fallen entirely, and he couldn’t shake the thought of his fresh rabbits, his cabin, and his gorgeous young step-sister, waiting in terror for his return. He grew more desperate to return to her with each passing second. When one faces mortal danger, the most important things spring to the fore. In those crucial moments, Alex thought only of Kaylee.
“Spark dat shit up, boss,” one guard said, his smile a disembodied flash of white.
“We ’bout ta git dis berffday party poppin’,” the other guard said, presenting the lighter. “I got dibs on dis sissy’s pretty lil mouf.”
Alex looked up in horror. His sissy mouf was covered with pretty pink lipstick and gloss. The black giants, shirtless and rippling, stared down with menacing glee into his eyes. The silence of the forest made the anticipation even more unbearable.
Alex had never been sexual with anyone. He was eleven during the revolution. And ten years hence, he’d been locked in chastity and sissified. He lived like a sexless eunuch. He felt frustrated, repressed urges for Kaylee. His heterosexuality constantly lurked in the background, wanting to break through, but the E pills and chemical castration tamped it down. He never experimented with other sissies. He couldn’t believe that this would be his first sexual experience: a filthy, drug-fueled, depraved transaction to spare the life of his step-sister.
Alex hated his black conquerors, no doubt. But it wasn’t just hate. There was something deeper at work. As he watched them puff the ganjala blunt, their proud and chiseled black bodies glistening in the night, his complicated feelings were at war with each other. Beneath the hate was boundless envy. Rage, envy, frustration. They mingled together as he stared up at those black hulks, who looked to him like vengeful gods.
They’d wrecked his civilization. They’d torn the beloved institutions to the ground. They’d left the southern United States a smoldering ash heap of drugs, debauchery, hip-hop hedonism, and thoughtless violence. And now, standing tall above him, they were about to use his mouf as their personal fuck-hole.
Alex felt low. Dirty. Pathetic. Lower than the earthworms slithering through the ground beneath him.
“Nigga, I’m trippin’,” Jamal said.
His eyes were red and bleary. They opened wide, like he was seeing the world for the first time. The guards followed suit, and their expressions were similar after their first puffs. The forest became a phantasmagoria for them: a psychedelic wonderland of color and vibration. And on his knees before them knelt a fresh cut of the finest whiteboi meat.
“Hit dis shit, whiteboi,” Jamal said, presenting him with the blunt.
“I-I shouldn’t,” Alex said, turning his head away.
“I didn’t fuckin’ ACKS you, bitch!” Jamal slapped Alex’s face with his backhand: a firm and jarring pimp-slap. “Hit dis shit, sissy-ass bitch!”
№134592[Quote]
Jamal held out the long, fat blunt. Its red cherry smoldered. Alex, kneeling at Jamal’s waist, pursed his lips and placed it on the blunt. He pulled a tiny bit of the ganjala smoke into his mouth, pretended to inhale, and blew it back out.
“Hell naw!” one of the guard growled. “Hit dis shit DEEP.”
His huge black hand seized Alex’s throat. He shoved the blunt back between Alex’s glossy sissy lips. Alex was defiant, but he had no choice. He pulled a long draw from the blunt. From his throat down to his lungs, the smoke singed his insides. His eyes watered and he coughed as the ganjala went to work.
The black kings laughed. Their eyes became glassy. Their stoned eyeballs rolled merrily to and fro in their skulls. Alex coughed and tried to choke down the noxious smoke, and the three of them took even deeper hits of the sacred plant.
“Dis shit craaaay,” Jamal said.
His eyes danced all over. He looked up into the forest canopy, back down to the ground, and stopped to examine how strange his own hand looked under the woozy influence of the ganjala. The drug was working. It hit his bloodstream and drove him into ecstasy.
Alex felt it, too. It started as a body-wide tingle. It warmed him. It embraced him with a celestial hug. A drunken warmth, a cosmic vibration, settled behind his eyes. Alex glanced up at the forest, which looked totally dark before, but now seemed alive with blue and purple moonlight. It was electric. Every square inch of the forest sang with mystery and life. Despite the mortal peril he was in, the ganjala transcended his panic. His consciousness lifted outside his sissy body, and he seemed to view the situation from high above, where the wisest owls perched.
“Dis shit got me retarded,” one of the guards said, hitting it again.
“Happy muhfuckin’ berffday, boss,” the other brute said.
Jamal smiled. His eyes were alight with the dangerous, drunken stupor of a street hoodlum. Yet he was a high-ranking officer in the military of a sovereign nation-state. How had the world become so absurd and cruel? Alex stared up at the black kings in wonder.
But wonder was only the first stage. They forced Alex to take another hit, and the next phase of sensations washed over him. What was this surge of fascination? Alex felt it down in his gut, in his solar plexus, deep below. It radiated outward and tickled his flaccid sissy clit. His sensations heightened. Now everything glowed and hummed with life, not just the shafts of moonlight raining down from above. He looked up at his captors, and he could tell they were in a similar state of divine stupefaction.
“You made good on da first half a’ yo’ promise, whiteboi,” Jamal said. “Dis shit is da real muhfuckin’ deal.”
Jamal took the bag of ganjala and handed it to one of his guards, who stashed it in the leg pocket of his olive drab cargo pants. He took another huge puff on the blunt. His lungs filled completely, and he exhaled the billowing ganjala cloud into the night air.
The mood shifted. No more fun and games. It wasn’t lazy, merry wonderment anymore. The three black kings stared down at their prey. Alex had made a deal. He’d offered his body to his conquerors, and they aimed to take full advantage of him. Their smiles became menacing. Hungry. Aggressive.
All three of them had a taste for sissies. Back in Atlanta, they walked the streets and served as comfort toys for their black masters. But Alex was especially pretty and “passable”. They examined him as he knelt helpless before them: his pretty wig, dropping in slutty waves over his shoulders; his pouty dick-sucking lips, decorated with pink lipstick and gloss; his short skirt, revealing supple and smooth white legs in fishnet stockings. They weren’t just horny. They were in heat, like wild animals. The ganjala had settled into their bloodstream, and it was pumping blood into their massive black pythons.
№134593[Quote]
“Lemme acks you sumpin’,” one of the guards said, feeling his cock through his pants. “You eva’ tasted black cock befo’, bitch?”
“N-no,” Alex whispered.
The thought occurred to Alex that he should run. Take off into the deep woods. Leave it all behind. But he had to face up to the violation. He pictured Kaylee. He thought of what these brutish conquerors would do to her if he failed. They’d wreck her body. They’d leave every hole a gaping, cum-filled mess, and they’d breed her with litter after litter of black babies. He imagined the horrifying image of Kaylee’s arms full of weeping jet-black babies, all grasping and craning their necks to suck milk from her white bosom.
“Hit dis shit one mo’ time,” Jamal said.
Alex did, deep and long. The ganjala seized him. It gripped him with a strange desire. His rage gave way to envy and fascination. Through glassy eyes, he looked down at his soft, feminine white body. Then he stared up at the chiseled, muscular perfection of those virile black gods. Some basic truth about his place in the pecking order, long denied but unstoppable, emerged under the influence of the ganjala. Alex fought against it, but it overtook him.
“Dat’s a pretty muhfuckin’ mouf,” Jamal said.
The three black kings were drunk with lust, riding high on the cloud of ganjala. And Alex’s perceptions became warped. He felt a growing sense of awe and worship for their bodies. So muscular. So dark and powerful. So unlike him. He took another puff, and Jamal took the blunt from him.
“Take a good muhfuckin’ look at dis shit, whiteboi,” Jamal said, the blunt dangling from his big African lips.
Leaving his belt fastened and his pants on, Jamal unzipped. Through the hole of his boxers and the fly of his pants, he produced a staggeringly beautiful black cock: enormous, heavy, and veiny, with precum dribbling from its purple head. It was the size of Alex’s arm. Engorged with blood and pumping harder with each throb, it swung down between Jamal’s legs, past his knees.
The guards followed suit. They kept their pants on, and through their flies they pulled out their glistening black cocks and low-hanging black balls. Though Jamal was slightly thicker, the guards’ cocks were far longer: even bigger than Alex had anticipated from two seven-foot-tall giants. They seemed unreal — exposed and hanging in the breezy night air — the moonlight reflecting a blue sheen on the ebony skin.
“Holy fucking shit,” Alex whispered.
The ganjala added a surreal strangeness to the vision of black power before him. He looked down between his legs at his little limp clitty tucked in chastity, then back up at the three swinging cocks. He looked at his sterile pink balls. Then back at their heavy, enormous black nuts filled with future generations of black warriors.
“You’re fucking huge,” Alex whispered again, his mind racing.
His sensations grew more acute. He smelled the powerful, manly musk of their cocks. It was a rich, heady aroma: full of power and danger. He hated them. He hated the sight of them. They were destroyers, these black kings. A menace. Ruiners of all he held dear.
Even so, just look at them. Those rippling muscles. The superior physicality, the raw animal strength born from centuries of oppression, now weaponized against the oppressors. Look at those chiseled abs, those huge pecs, those biceps. He was in awe of the guards especially, with their tribal paint and tattoos, their golden ceremonial bands around their massive biceps.
№134594[Quote]
Alex fought their allure, but the ganjala undercut him. Every time he tried to snap out of it, to remind himself of their vileness and debauchery, his senses overpowered him. What was this feeling? This ancient sensation? Was he… getting hard? How? He felt his cock, which had laid dormant since childhood, grow plump inside its cage. Despite the chemicals and E, he wasn’t impotent. His libido surged with life.
“Dis what a real grown-ass dick look like, bitch,” Jamal said, stroking.
“Dis why yo women don’t want none of dat little baby dick,” one of the guards grunted.
Their dark fleshy anacondas were eye-popping. Alex thought of what they’d do to a nubile white princess like Kaylee. They’d wreck her body. They’d pound into her cervix, flooding her womb with seed. How could he ever hope to compete? The sight of their cocks filled him with rage, but it transmuted into an angry lust.
“Open dat mouf, sissy-ass faggot,” Jamal commanded, the blunt dangling from the corner of his lips.
Alex did.
“Look up. Look up at me, bitch,” he growled.
Alex obeyed. The three black muscle-gods stared down into his pink mouth. His wet, warm tongue shone in the moonlight. Jamal’s cock was fully engorged now. Its head dripped heavy droplets of salty precum, which coursed down his shaft in beads. Jamal’s huge black hand reached around and grabbed Alex’s head, pulling him in.
“Suck dis nigga dick, faggot,” he demanded. “Git used to da taste.”
Alex closed his eyes as his captor guided him. Sucking his first cock was traumatic enough. But doing it under the influence of ganjala intensified each sensation. Alex had to part his glossy sissy lips wide to accommodate the massive head. The two guards tugged their huge dicks as they looked on. Jamal passed the blunt to them as he worked his way into Alex’s mouth, and they smoked more — getting higher and higher with lust — as they watched him fuck the helpless whiteboi’s face.
“Hell yeah,” Jamal grunted, his lip curling into a scowl, watching his sissy slut suck.
Alex was bombarded with the taste, the feeling, the scent of the beautiful black dick. It was salty, fleshy, human, and delicious. It tasted like raw manhood. It was hard and throbbing, but it glistened with silky smoothness as it passed through his lips. It was only a third of the way in, and already Alex’s eyes began to water.
What would Kaylee think if she saw me doing this? Alex wondered as he sucked. She was too pure a soul to even contemplate it. She must never know he did this to save her. It was humiliating. And the worst part was, as that gorgeous black cock slid into the back of his slippery throat, he was beginning to… sort of… like it.
“Relax dat throat, you fuckin’ faggot,” Jamal barked.
Alex’s eyes watered and tears rolled onto his cheeks. His eye makeup ran as the brutal inspector parted his warm, wet tonsils with his cock-head. Alex glugged and gulped the dick, fought for air as it fucked his face, and felt his face turning purple as it bottomed out, over and over, deep in his throat. Despite the misery, Alex felt the overwhelming urge to touch his clitty. He reached down and felt the cold synthetic plastic cock cage, unable to find any satisfaction.
“Don’t you DARE touch dat got-dayum clit cage,” Jamal said, putting thrust into his strokes. “Whitebois ain’t gittin’ NO MORE muhfuckin’ pleasure.”
№134595[Quote]
“Dat’s rite!” one of the guards growled, throwing up an angry black power fist.
The ganjala blunt was finished. The guard took the butt of the blunt, reached down, and extinguished it on Alex’s thigh. Alex wailed, Jamal’s cock choking him, as it burnt his skin.
“Ya’ll got enough pleasure,” Jamal grunted, fucking Alex’s face even harder. “RAPIN’ and OPPRESSIN’ my ANCESTORS!”
“Tables is turned now, bitch!” the guard said, slapping Alex’s face as Jamal fucked his mouth.
“Now look at you,” Jamal said, pushing the limits of Alex’s throat. “You was da boss, and now look at you. Chokin’ on SLAVE cock. Now YOU da slave, you sissy-ass bitch! We run dis shit! Now NIGGAS runnin’ da plantation!”
The three black kings marinated in the cruelty. Their eyes were bleary, flying high as Georgia pines, riding the sex-crazed fumes of ganjala, and their giant pythons throbbed harder. They all loved to fuck white women. They loved pumping them full of black cum to eradicate the oppressors’ recessive genes. But fucking a whiteboi sissy was a gourmet sort of pleasure: it carried the dual intrigue of sex and humiliation. It was turbocharged with the weight of centuries of vengeance.
Glug, glug, glug, glug, glug. Alex’s tears rained trails of mascara down his sissy cheeks. Jamal bottomed out. His huge black balls smacked Alex’s chin with each brutal pump. Alex grabbed the enormous black balls and shaft with his hands. He jerked and pulled on them, teased them, tried to coax them into orgasm fast so he could rid them from the village.
“My turn, bitch,” one of the guards groaned, deep and gravelly.
Jamal pulled out. A trail of Alex’s throat-slobber hung from his glistening cock as he pulled away. Just as soon as it was out, the guard had slipped in. He was even longer than Jamal, and he fucked Alex’s face even harder.
“Dat’s rite, dat’s fuckin’ rite,” he mumbled as his cock rammed its way down Alex’s warm throat, down almost to his stomach.
Every time Alex gagged and choked, the guard pimp-slapped him: hard backhand knuckles across his sissy face. As Alex weeped and gagged and sucked, Jamal and the other guard leaned down to grab handfuls of his round sissy ass underneath his skirt.
Alex stood up higher on his knees. Jamal and the guard lifted the back of his skirt and ogled his soft white flesh: a perfect sissy bubble butt. Alex submitted to them fully. When he felt violated, when he wanted to break down, he thought of Kaylee’s face. He thought of leading her out of the wilderness, going on the run, escaping New Africa.
Perhaps it was the ganjala, but the visions were crystal clear and vivid: sweet step-sister Kaylee, a beautiful blonde blushing bride, marrying Alex in some faraway land. It sustained him as the black kings conducted their sexual onslaught.
“Peep dat shit, nigga,” the guard said to Jamal, looking down at Alex’s virgin ass.
“Dat sissy ass was built for dis big ol’ black dick,” Jamal said.
The guards swapped places. Alex now tasted his third black cock. One cock pounded his tender throat while a pair of black hands caressed his ass and fingered his quivering little boipussy. They pulled his thong panties to the side and probed his tight ass. Alex groaned and moaned between gags.
It was a nightmare. It would have been bad enough if the experience was pure torture. But the fact that Alex sort of liked it made it even worse: self-hatred on top of the humiliation. Some deep, fucked-up part of him relished his violation and brutalization.
№134596[Quote]
“How dat dick taste, faggot?” the guard yelled. “Is you gonna cry, whiteboi?”
The seven-foot monster’s hips churned with violent thrusts. His sweaty black nuts slapped Alex’s chin. Strings of slobber and mascara-tinted tears mingled atop the black shaft. Alex struggled to breathe. The guard’s huge hands grabbed his head and pink-and-blue wig, pulling Alex harder onto the throbbing pole.
“Hol’ up, lemme have dis bitch fo’ a minute,” Jamal said.
He pulled his pants down to his ankles. They bunched around his combat boots. Jamal’s legs were muscular, rippling with power. His hard black cock dripped with Alex’s slobber, and he turned around and bent at the waist. His powerful black buttocks came into view: chiseled, muscular haunches.
“It’s my muhfuckin’ berffday,” Jamal said. “You gon’ toss my muhfuckin’ salad, you colonizer FAGGOT.”
The guards pushed Alex’s sissy face into Jamal’s beautiful black ass. Jamal’s nuts hung low, and he jerked his cock as Alex’s face dove deep between his ebony cheeks. Alex, senses exploding on ganjala, disappeared into a realm of delicious flavor. He rimmed Jamal with his tender sissy tongue, drinking in the musk of a real man, his sexual superior.
“Dat’s rite,” one guard groaned, shoving Alex’s face deeper into paradise. “Git yo face in dat ASS, faggot. ALL UP IN DAT ASS.”
Alex rimmed and tongue-fucked Jamal’s hole, savoring the taste of a prime alpha bull. He dropped down and sucked his gorgeous black nuts. He felt them quiver in his mouth, the breeze tickling them in the night air. Then back up into his ass again, desperate to please him.
“Dis how da world work now, whiteboi,” Jamal said, breathing heavily, luxuriating in Alex’s tongue. “You nuffin’ but slaves, bitch. You gon’ serve us til’ you bred out. History books gonna’ say, dis is how whitebois ended: eatin’ black ass while dey women havin’ black babies.”
Alex was crying. He wasn’t sure if they were tears of rage, trauma, sadness, or shell-shock. These black kings had broken him. He wept openly as he ate Jamal’s sweet black ass. The taste lingered in his mouth, and it drove him wild. His little clitty engorged further, filling his tiny cock cage, as he licked a long slobbery trail up from Jamal’s nuts to his asshole and back again.
“Git dat tongue deep in dat ass, faggot. Dis what a KANG taste like,” Jamal beat his huge cock faster.
The guards played with Alex’s soft white ass. They fondled themselves with one hand, and fondled Alex’s asshole and little pink balls with the other. Every sensation was new, overwhelming, and dangerous to Alex. He’d spent his entire life locked in chastity, and this brutal awakening sent every nerve on edge. When he was a boy, he imagined his first sexual encounter being with a pretty, sweet blonde girl: someone like Kaylee. He had no idea he’d be used as a fuck-rag for big black slavemasters.
“Git dat tongue in dere!” the guard yelled.
They forced Alex even deeper. Alex stiffened his wet tongue, making it as long as he could, and he snaked it into Jamal’s ass, tongue-fucking with rhythmic passion. The guards’ grabbed his head and shoved him between Jamal’s black cheeks. In and out, in and out, Alex tongue-fucked his master as his little clit dripped dainty droplets of precum in its cage.
Jamal loved it. Alex reached his sissy hand up and jerked Jamal off as he tongue-fucked his black master. His tongue and his tugs worked in rhythm, and Jamal’s eyes rolled up into his head as his whiteboi supplicant edged him closer to orgasm. When Jamal got close, he pulled away, riding the edge of ecstasy like a pro.
№134597[Quote]
“Git over here, bitch!” one of the guards yelled.
He manhandled Alex, placing him on his knees between the three of them. The three enormous cocks throbbed in the moonlight in front of him. Alex groveled on his knees before them. His tears kept flowing, and so did the drips of sissy precum from his clit.
“You an uppity lil whiteboi,” Jamal said.
Their intense eyes, reddened with ganjala lust, stared down into Alex’s. They took turns slapping Alex’s face with their heavy, slobber-covered cocks. They slapped him with their cocks, then their hands, then their cocks again. Stiff black meat accosted him from all angles.
“When yo’ ancestas was oppressin’ my ancestas,” Jamal said. “When dem white CRACKAS was holdin’ down da BLACK KANGS, ya’ll had a way of marking ya’lls property. Ya’ll would burn a mark into a nigga in case he run away.”
Jamal pulled a small instrument from the pocket of his camo pants. It was a small cylindrical gadget, and with the click of a button, a red-hot heating implement telescoped out of the top, burning fiery orange. Alex had heard of these before. They were called insta-brands: originally used in the breeding pens to brand white women during their inseminations. Soldiers began using them to “mark” sissies they’d fucked, similar to a graffiti tag on a city wall.
“Who you belong to, bitch?” Jamal yelled, brandishing the insta-brand.
“King Jamal,” Alex warbled, in his best sissy voice, through the tears.
“Dat’s rite,” Jamal growled.
The two guards laughed and cock-slapped the little whiteboi.
“Dis right here,” Jamal said, nodding at the insta-brand. “Dis my mark. You try to run, you try to hide like a runaway slave… Err’body gonna know you JAMAL’S bitch! Got dat?”
“Y-yes, king,” Alex said, kissing the purple heads of their master cocks.
Alex would suffer any indignity. They could do whatever they liked. He fully submitted to their black power. Kaylee’s future — and perhaps the future of whiteness itself — depended on it.
“Bend dis bitch ova!” Jamal commanded the guards, the insta-brand casting an orange glow on his sinister face.
The guards picked Alex up and wrestled him to a doggy-style position on the forest floor. They pulled up his sissy skirt to reveal his round white ass. They pulled his thong to the side. His tight, virginal boipussy and his caged clitty and balls were exposed. Jamal basked in the sight. Fresh, beautiful, succulent white meat. Untouched. He licked his big, wet lips in anticipation.
“W-what are you doing, king?” Alex asked.
“Shut yo’ fucking mouf!” one of the guards pimp-slapped him and fed him a hot mouthful of black cock.
Alex felt the heat of the insta-brand descending closer to his round, white ass. He relaxed his throat and took gagging thrusts from the guards, bracing for the searing heat.
“Yeah, dat look good,” Jamal’s smile flashed with gold, platinum, and ruthless desire.
№134598[Quote]
Jamal’s heavy black cock fell atop Alex’s ass and lower back. Jamal spit on his cock as he slowly slid it between those fat white cheeks, as though he was titty-fucking a white woman. Alex shivered and shook from the ticklish friction. Holding the insta-brand inches from Alex’s right cheek, Jamal massaged Alex’s pink hole with the head of his dick.
“You want dis dick?” Jamal asked.
“Y-yes, king,” Alex said, bobbing on the guards’ cocks.
“Beg fo’ dis dick,” Jamal said, sliding between those soft cheeks.
“P-please, king, fuck me!” Alex moaned. “I NEED that royal cock, daddy.”
Jamal reached down with his left hand and grabbed Alex’s shoulder and neck, preparing for insertion. Alex felt the heat of Jamal’s sweaty cockhead teasing his puckering asshole. With a solemn grunt, Jamal started sliding into Alex millimeters at a time, tearing apart that snug little hole.
“Oh my f-f-ucking god,” Alex groaned.
“Dat’s rite,” Jamal mumbled, watching his huge black dick parting those sweet white cheeks. “Open up fo’ Daddy, bitch.”
The pressure, the burning, stretching, tearing pressure built as Jamal’s cock edged forward. He was only a third of the way in, and already he’d hit clenching resistance from Alex.
“Open dat ass up,” a guard growled.
“I-I can’t, k-k-kings,” Alex cried.
“Open da fuck up, whiteboi!” Jamal screamed. “Or I’ll brand yo’ ass!”
Alex fought to control his breathing. His hands clung to the grass on the forest floor, and he tried to calm himself. Jamal’s enormous dick felt like a freight train running right through him, barreling through his insides, but he overcame the urge to fight it. Instead of clenching down on it, he accepted the violation. He let it in. He let his ass accept the glistening daddy dick.
“Dat’s good,” Jamal groaned. He kept his tough exterior, but he was obviously in love with Alex’s sweet little boipussy. It felt amazing gripping his giant black python. “Dat shit feel real fuckin’ good. Fuck yeah.”
Jamal thrust further inside Alex. And further still. Finally Alex’s ass clenched again, with Jamal’s cock only halfway inside him.
“Muhfuckin’ faggot!” Jamal yelled, frustrated. “We dun’ tried dis da easy way, we gon’ have ta do dis da hard way, bitch. Open da FUCK up!”
Jamal buried the hot insta-brand into the soft white flesh of Alex’s right ass cheek. As the brand seared into his flesh, Jamal thrust his huge black dick all the way in, balls deep, as Alex’s body reflexively bucked and struggled against the pressure and searing heat.
“Ahhhhhhh!” Alex screamed, his wails echoing into the night.
“Take it, faggot!” one guard said, shoving his cock into the whiteboi’s mouth.
“Stop cryin’, bitch!” the other said, slapping his heavy dick against Alex’s face, tears falling down atop its shaft.
Jamal held the insta-brand down, making his mark deep and long, while he fucked his sissy slave’s asshole. No more mercy. Alex’s ass clenched with spasms, but Jamal powered right through them. He destroyed Alex’s tender insides. Each thrust was another dagger. Alex felt the warm, throbbing heft of
№134599[Quote]
Jamal’s master cock within him, cutting through all resistance like a flaming sword of vengeance.
“Ya’ll was on top, wasn’t you?” Jamal snarled while he fucked. “White man ran da world!”
“Mm-hm,” Alex moaned as he gagged on sweaty daddy dick.
“Now look atchu, bitch!” Jamal screamed. “You just a hole. A wet hole for black dick!”
Jamal threw all his power into his fucking. He showed no regard for Alex’s feelings. He used the little sissy, with his pink-and-blue wig flowing in the breeze, as a masturbatory aid. Alex was fresh white meat: nothing but warm friction for the black kings.
“Yo country belong to us. Yo bitches belong to us. You ’bout to go extinct,” Jamal grunted.
His rage powered his strokes. His muscular black ass clenched and relaxed, over and over, as he slung hundreds of years’ worth of revenge and oppression into the sissy’s tender boipussy.
“Y-y-yes, king!” Alex howled.
Jamal finally pulled the insta-brand away from Alex’s cheek. His round white ass now bore a fresh, permanent brand: the symbol of a stylized spade, with a “J” for Jamal, inside a circle. It was an eternal reminder that he was owned by black kings, and his holes had been claimed by them.
“You like dis big black dick?” Jamal taunted.
“Y-y-yes, king!” Alex sucked the guards, alternating between them, wildly licking their nuts and their shafts between sucks.
Jamal ran through Alex’s insides. He shredded them. But through the pain and the tears, a deep sensation built up underneath it all. Alex’s clitty stiffened, plumping up against the confines of his cock cage. His little pink balls radiated with pleasure as, with every stroke, Jamal’s powerful nuts plowed into them. Something strange was happening. Call it Stockholm Syndrome or call it simple sissy submission, but Alex began to give his body, his will, his soul over to his masters.
And it hurt really fucking good.
“D-d-daddy!” Alex whimpered. “I l-l-love that cock Daddy!”
Jamal’s deep grunts intermingled with Alex’s sissy cries. Dark muscle on soft white flesh. The buzz of the ganjala lifted them higher. Overwhelmed with fuck-lust, the two enormous guards seized control from Jamal.
The first guard lifted Alex up with ease. He pulled him roughly upward, like a sissy ragdoll, and Alex threw his thin white arms around his shoulders to hang on for dear life. Face-to-face, Alex’s hole still reeling from Jamal’s onslaught, Alex opened his mouth and began kissing the humongous musclebound guard.
“Look out. Dis little whiteboi bitch in love,” Jamal said, stroking himself.
The other guard and Jamal watched, their eyes red with ganjala haze, and jerked off as Alex gave himself over to black domination. He’d resisted before. He’d tried to hang onto some thread of masculinity, but in the heat of interracial passion, he became a submissive fuckslut.
“Dat’s what I’m talkin’ ’bout,” the other guard said, stroking himself. “Dis your place,bitch.”
№134600[Quote]
As the massive guard held him aloft, his chiseled muscles slick with sweat in the night, Alex felt the true power of a black king. He sucked the guard’s sweet pink tongue. He nibbled and kissed those huge African lips. He traded spit with him, then kissed his ear, his cheek, and his neck. The guard grunted and groaned, and he inserted himself into Alex’s boipussy as he held him.
“F-f-fuck that’s g-g-g-ood, king!” Alex groaned between kisses.
It was a totally different feeling being fucked from this angle. Just as intense, just as painful, but a powerful aching pleasure lurked beneath it. The first pangs of deep pleasure were like catching sight of an iceberg. Untold fathoms of lust and satisfaction lay beneath, and it deepened with every thrust of the black king’s cock.
“Dis why yo’ women betrayed ya’ll sissies,” Jamal shouted over the grunting and moaning. “You feel it now, whiteboi? You get it now?”
“I do,” Alex mumbled, overwhelmed with cock-lust.
Alex rode harder. His clitty felt poised to explode. He wanted desperately to touch it. To play with it. He’d never done it before. All his life he’d been in chastity — locked up tight like a good celibate sissy boy. But these black cocks awoke the flame of lust in him. He was ashamed, but his lust overcame the shame. Could it really be happening? What was this tingle? This crescendo? Was he going to cum?
“Got-dayum, dat’s tight, got-dayum it!” the guard plowed Alex’s warm guts, harder and faster.
Alex dug his hot-pink fingernails into the guard’s muscular back. They became animals in the wilderness. Nothing existed but them, cloaked in the warm ganjala buzz.
“That f-f-ucking c-cock is HUGE,” Alex whispered sweet nothings in his black master’s ear, and it inspired even harder thrusts.
Alex’s ass ate up that black dick. His boipussy was ruined. Each thrust loosened him up more, greased his insides, and plundered his tender tissues and muscles. He kissed the guard again, madly and passionately. The contrast was unreal. The rough, angry, vengeful thrusts counterbalanced by the tender kisses between daddy and sissy, master and slave, black and white.
“Gimme dat slut,” the second guard demanded.
The guard handed Alex over to him. The second guard inserted, pumping away at Alex’s right boipussy in the same position as Jamal looked on.
“Fuck, dis whiteboi’s tight,” he said.
Alex caressed his bald head, his arms wrapped around him, hovering seven feet in the air. Alex wondered what it would feel like to be that tall, that muscular, that powerful. The heft of the guard’s body reminded him of his place in the racial pecking order. It was a brutal truth. Whitebois like him had been conquered. They’d been ruined. They were made obsolete.
Alex felt grateful that he could protect Kaylee from this knowledge. She must never know the touch, the feel, the overpowering allure of the black kings. If it meant pimping his little hole out to them, he’d gladly do it to keep Kaylee pure. Once you’ve felt their power, it’s seared into your mind forever: like the fresh spade branded on his ass, burning with pain.
“Loosen dat ass, bitch!” the guard grunted.
Alex obeyed. Tears ran down his face again, smearing his sissy makeup, as the guard wrecked him. Alex was beginning to gain some control over his spasms and contractions. He relaxed himself as the warm, wet, veiny tool of black supremacy ravaged him.
№134601[Quote]
“I’m finna nut,” the guard yelled. “Got-fuckin’-dayum, I’m finna nut up in dis faggot!”
He howled and grunted. He was a wild beast in the forest. The moonlight shone on his dark features. A wet sheen of sweat coated his rippling body, and Alex clung tighter to him. He dug in with his nails. His toes curled. His clitty engorged.
Alex kissed him wildly. He sucked his long, tasty tongue. Alex opened his warm, wet sissy mouth and let his master spit in it. Alex gratefully swallowed his African spit as he relaxed into deeper thrusts.
“Fuck me, king!” Alex encouraged him.
The guard raged and bucked. His body went ballistic. He slammed Alex with insane force, Alex’s sissy ass slapping and reddening as it tore apart. Alex closed his eyes, swirling in the vortex of powerful African libido.
“Stay right dere,” the guard said.
Jamal and the other guard held Alex still, holding his body up in the guard’s preferred position. Alex’s sissy clitty seeped precum, his little balls bounced up and down, as his hole was plundered waist-high off the forest ground.
“Fuckin’ faggot, you TAKE DIS NUT!” the guard screamed.
Veins popped out. Muscles flexed with exertion. The vascularity in his huge African muscles pumped up. His eyes grew intense. The warrior gene — the unconquerable African tribal spirit — rose up with fury as the massive guard used the sissy’s pink hole to cum.
“Ahhhhhhhhh fuuuuuck!” the guard howled.
Alex now knew what a white woman felt like at the breeding facilities. Helpless. Overpowered. In total awe. The flood of warm, potent, alpha jizz pumped in huge spurts. Contraction after contraction, the guard shot buckets of heavy, thick, precious African cum into his soft sissy guts.
“Dat’s rite! Breed dat lil’ white faggot!” Jamal yelled.
“Fill dat ass up!” the other guard encouraged.
Alex rode harder through the guard’s orgasm. As he did, he edged closer himself. At least he thought; Alex couldn’t be sure. His little clitty was tucked away and, besides, he didn’t know what an orgasm felt like. All he knew is that as he gyrated on that huge daddy dick, a delicious tingle filled his balls, his clitty, and his belly. The warmth of the cum greased the searing pain of the dick, and the guard’s thrusts became wetter and sloppier. It was heaven and hell at once: a nightmarish, aggressive, brutal paradise of untamed black lust and rage.
“Got-dayum!” the guard kissed his sissy bitch as he filled his belly up with jizz. “Dat’s gooooood.”
The guard produced at least five times his typical volume of cum. The ganjala had blown his balls up to epic proportions, and its rumored orgasmic enhancement proved to be true. The guard’s face contorted into pure bliss. That snug little sissy hole squeezed out the best orgasm of his life.
“It’s so warm, king,” Alex whispered into his black master’s ear. “It’s oozing inside me.”
“Git da fuck down here. My muhfuckin’ turn!” the second guard yelled.
He grabbed Alex by the neck and threw him to the forest floor, pulling his tight asshole off of his fellow guard’s spent cock. The cum threatened to ooze out of Alex’s boipussy, but the guard wrestled him into a “face down, ass up” doggy-style position.
№134602[Quote]
“Show me dat ass,” the guard commanded.
Alex lifted his round sissy butt up into the air. As he hiked it higher, gravity sent the thick gobs of African cum further into his insides. It slid deep within him — viscous and warm — coating the tender tunnel ravaged by their big black cocks. Alex’s little clitty dripped more precum, and he prepared for another hot injection of jizz.
“Dis what you get, whiteboi, fo fuckin’ wit my ancestas,” the second guard threatened. He worked the head of his dick into the sissy’s asshole. Sweat dripped from his mighty, simian brow. “I’m gon’ FLOOD you ass’ wit dis NUT!”
“Do it, soul brotha!” Jamal encouraged him. “Break dis’ lil’ bitch!”
Jamal sparked up a joint: this time regular military-issue weed. All New African soldiers carried packs of pre-rolled joints with them. He jerked himself off and took long draws from the joint. The weed buzz complemented the ganjala nicely.
The second guard was bigger than the first. His cock was just as long, but even thicker. Alex wailed in aching agony as it stretched him. The guard’s huge black hands wrapped around Alex’s thin white hips and pulled him into his body.
“Who you love, bitch?” he barked.
“I love YOU, king!” Alex cried.
“Who own you, bitch?” he barked.
“YOU own me, king!” Alex moaned through mascara tears.
This ritual humiliation pleased the second guard. The pace of his fucking grew rapid. It became hectic and ecstatic, less regular, more feverish: sure signs an overpowering orgasm was building. Inspector Jamal relished the sight as he filled the air with dank weed smoke. He couldn’t look away: a thick, wet, glistening black dick splitting those soft white cheeks in two, gliding back and forth through the snug aperture, his homeboy destroying that tender hole and claiming it for the greater glory of the black race.
“Pound dat shit,” Jamal coached his subordinate. “Show dis whiteboi how a REAL nigga fuck.”
Jamal put his boot on Alex’s head and forced his face down into the grass. The guard pounded out thumping, heavy thrusts, busting Alex’s tender ass cheeks, tearing into him.
“Dis is fo’ slavery! Dis’ is fo’ Jim Crow! Dis is fo po-leese brutality!” he cried.
Each thrust was a micro-reparation. Each shredding, angry slam was righteous justice. The guard was drunk with lust and retribution. The twin forces fed each other, and his gigantic seven-foot frame reeled with apoplectic arousal as he fucked his way to orgasm.
“F-f-uck yeah, I’m gon’ nut!” he growled from his deepest being.
Jamal held Alex still as the second guard filled him up. No wiggling. No struggling. He would take the cum injection like a good slave bitch. And he did. Alex sobbed softly, relaxing as best he could, his tiny cock tingling with desire and shame.
“Ahhhhh FUUUCK!” the second guard lost control.
№134603[Quote]
His explosion was even angrier, more forceful, and thicker than the first. Oceans of pearly white cum rampaged through Alex’s insides. The African seed added to the vast reservoir already within him, and Alex felt a sensation of warm fullness.
“Oh sheeit! Is you still nuttin’?” Jamal asked, smoking his joint and tugging himself.
“Yeeeessss,” the second guard’s face contracted and twitched with fury. His nostrils flared. His bleary eyes squinted. The corners of his huge lips curled downward in deep mammalian bliss. “S-s-still nuttin’.”
For a full thirty seconds, the guard’s trembling cock shot fresh ropes of cum. His balls quivered and shook, and they contracted back down to normal size as the ganjala-fueled cumload filled the sissy’s belly. Finally, he came to rest, breathing heavily in the cool night air.
“It’s so fucking warm, kings,” Alex whimpered. “I’m full of cum. I’m ready to fucking burst.”
“You ain’t seen shit yet,” Jamal said.
He handed his joint to the second guard, who pulled his giant limp cock out of Alex and stood beside his other seven-foot cohort. They were in for a show. Even though Jamal was shorter and less slighter than his guards, he burned with masculine African virility. He’d fought in the revolution, and it hardened him into a pitiless brute.
“You best make room up in dat ass, bitch, cuz Daddy finna fill you ALL DA WAY up,” Jamal said, squeezing Alex’s tender ass. He examined his gaping boipussy, dripping with warm cum, filled up like a pastry overstuffed with cream. “Turn over, bitch!”
Jamal threw Alex onto his back. The cool grass caressed Alex’s sweaty, ravaged sissy body. The ganjala high was peaking. The world was surreal and vivid. Every nerve stood on edge. He laid on his back, his quivering sissy clitty begging to be touched, but locked in a permanent frustrated chastity.
The ganjala had swollen the inspector’s balls. His nuts filled up with jizz, and he ached for release.
“Get yo’ muhfuckin’ legs back!” Inspector Jamal grabbed Alex’s soft, supple white legs behind the knees and pushed them back like a contortionist. His sissy heels and ankles wrenched back, almost behind his head. Gravity once again settled the buckets of cum inside him. “You best open dat ass up, slut. It’s my berffday, got-dayum it.”
Alex peered into those cold eyes. Jamal meant business. The complicated symphony of anger, rage, hate, and desire swelled to its grand finale. Alex fought back tears, focusing on Kaylee. He looked past Jamal’s muscular body, out into the dark horizon of pines, and whispered “hang on, baby.”
Jamal laughed at Alex’s tiny little clitty. He slapped it with his heavy cock, rattling its chastity cage. The vibrations drove Alex insane with desire. Despite the shame, he wanted nothing more than to rub his little nub against Jamal’s beautiful master dick. He wanted to know what pleasure felt like.
“How you like dat, whiteboi?” Jamal asked as he inserted.
“I l-l-love it, king,” Alex cried, fighting to relax his ass.
Jamal grunted loudly, with proud groans. As he savagely wrecked Alex’s little hole, as his huge black cock sloshed amid the sloppy cum inside, as he pounded balls-deep into his slave, he made Tarzan-like shouts of triumph.
“Who’s yo’ muhfuckin’ Daddy?” Jamal screamed.
“I-Inspector J-Jamal,” Alex sobbed.
№134604[Quote]
“Who run da world?”
“Black k-kings!”
A strange and terrible quaking overtook Alex. It emanated from the deepest parts of him. It might have been the angle, or the rhythm, or merely the ganjala, but Jamal’s violent thrusts gave him waves of intense pleasure. Holy fuck, Alex thought to himself. He’s hitting my prostate.
Jamal dominated Alex completely. He fucked his little cum-filled ass brutally, his muscular frame holding him against the forest floor. The electric sweat dripped from the black king’s torso. Alex held onto the sea of rippling muscles, riding the unbridled black power. Each time the black king bottomed out, a tingle snaked up into Alex’s little pink cock.
“It’s over for ya’ll bitches. Ya’ll on da way out. Extinct,” Jamal growled into Alex’s ear as he neared completion.
The guards, exhausted from their orgasms, looked on as though they were witnessing a sacred ritual. Jamal grunted, angry and vengeful, his hot breath on his sissy captive’s ear. And in-between the cruel taunts, he kissed Alex with dominating, aggressive, open-mouthed smooches — his long tongue probing the mouth of the helpless little whiteboi.
“You never was nuffin’,” Jamal growled. “Ya’ll just stole and colonized. And held us down! You ain’t shit. You feel dat? Dat’s a real man’s dick! Dat dick gonna fuck yo’ mom and yo’ sista! Dat dick gonna end ya’ll white faggots foreva! Yo’ women gonna nurse our black babies, faggot!”
Alex cried and wailed, holding tight. The thrusts hit all the right spots. Waves of shame and anger washed over him, but lust won out. There was no denying the power of the black man. Jamal was a force of nature, and he swept over Alex’s soul like a hurricane.
“Daddy I’m g-gonna c-c-c-um,” Alex screamed.
Without touching his nub, with only the furious thrusting friction of his black master’s cock, Alex went over the edge into the infinite, painful bliss of orgasm. It was a hands-free prostate orgasm, surging up with tremendous force from his innards, gripping all extremities with turbulent, brain-melting pleasure.
“F-F-Fuuuuuck!” Alex whined and wriggled.
In the blinding joy of the orgasm, Alex clenched his tearful eyes tight. Time stood still. In a vision, he pictured Kaylee in a wedding dress, under the shade of a tree along some spectacular Appalachian ridge. She lifted her veil and stared into his eyes. He disappeared into her precious, rare, otherworldly Aryan features.
“Dat’s rite,” Jamal yelled, making Alex’s sissy ass cum, watching the sissy jizz dribble out of Alex’s locked-up cock into the clear cock cage. “Kiss me, faggot.”
The black master kissed his sissy with a wet, open mouth. As his tongue invaded Alex’s mouth, Jamal went over the edge into his orgasm. The build-up was long and gradual. Like a tidal wave it crested slowly and built to dizzying heights. With angry grunts and growls — in monosyllabic rasps of hatred and malevolence — the hulking black brute bred Alex’s sissy guts.
“Got-dayum, white, bitch, fuck, got-dayum, cracka ass, bitch,” Jamal mumbled angry curses as he plowed through his wild orgasm.
“I’m s-s-s-o fucking full, king,” Alex cried between kisses, still riding his prostate orgasm.
№134605[Quote]
Jamal’s diamond-hard master dick spurted buckets into Alex. It felt like gallons. It was a warm, unending, savage injection of African semen. Its hot potency filled Alex fuller and fuller, as though his belly was about to burst, and Jamal’s quivering balls shook between long contracting ejaculations.
Gripping and kissing his brutal black master, legs wrapped around his superior body, in awe of the strange warmth of his first orgasm, Alex welcomed the African cum. He was proudly a martyr. He relished the full feeling, the flood of the hot poison that would wipe away his race, if only to save Kaylee from knowing its horrifying power.
“Dat’s rite, I own you, bitch,” Jamal mumbled to himself in lusty exhaustion. “I own you. I own you.”
On the forest floor, beneath the gorgeous naked bodies of his black conquerors, Alex stared up into the pale shafts of moonlight. He decided, then and there, that he’d never tell Kaylee what her freedom had cost. And he most certainly would never tell her that, in the fucked-up depths of his soul, he enjoyed the brutality so much his little clitty came.
“Hell of a berffday present, huh boss?” a guard asked.
“Got-dayum rite,” Jamal said, shoving Alex’s spent body on the floor like used trash. “Now let’s get up outta dis bitch. We done here.”
The black kings had pimp-strolled away, rolling a fresh ganjala blunt as they disappeared into the forest. When the last of the black master seed dribbled out of Alex’s gaping boipussy, he limped back toward his cabin to tell Kaylee she was safe. The black kings had done plenty of damage to the village, but Alex couldn’t wait to explain how he’d saved her by bartering only a small bag of their large ganjala cache (sparing her the grisly details). Even though he’d been humiliated, degraded, and ravaged, he felt like a triumphant martyr for the cause of whiteness.
The moon was high now. Alex’s sissy skirt billowed in the cool night breeze. His sissy ass ached. He came over the ridge to his cabin in a dreamy haze, full of a strange, wounded optimism. There was nothing more he could lose. His ego, his waning masculine pride, had been shredded by the demonstration of black power. This made him feel paradoxically free — ready, at last, to flee for freedom with his beloved. Step-brother and step-sister, the fate of the white race riding on their success, would make a run for it across the loose network of sissy villages dotting the landscape.
They’d do it together. The very next morning.
“Kaylee!” Alex called out as he arrived at the heavy cabin door.
“Alex!” her muffled voice cried out.
The door flew open with tremendous force, knocking Alex backward, into the front yard, onto his sore sissy ass. He brushed the pink-and-blue tresses from his face and looked upon his worst nightmare.
“Alex! Help!” Kaylee cried, sobbing in mortal terror.
The terrible truth dawned on Alex. After using his body for pleasure, Inspector Jamal and his guards had called in reinforcements.
“Let me go!” Kaylee yelled.
№134606[Quote]
She kicked. She clawed. She screamed. The massive New African soldier just laughed, carrying her over his shoulder like an ancient barbarian pillaging a village. Inspector Jamal and a unit of soldiers followed him out of the cabin, guns drawn, and doused the cabin with kerosene.
“You promised! You motherfuckers promised!” Alex rose to his feet and ran to Inspector Jamal. “Let her go! We’ll leave New Africa. You’ll never see us again!”
“Dis bitch fine as hell,” Jamal said through gritted teeth, blunt dangling from the corner of his mouth, eyes red with drunken joy. “She goin’ straight to Chief Darius X’s private chamber. We throwin’ dis fine-ass bitch to da PURESTRAINS.”
Alex’s blood froze. Kaylee looked desperately into his eyes, hoisted over the warrior’s massive black shoulder. All this time, they’d kept her from so much as laying eyes upon black men. And now the monsters came to capture her, helpless and flailing in the middle of the night. Her soft white skin, her fertile features, all that human potential, now mere chum to be thrown to the purestrains: the blackest, purest, most aggressive African supermen. Purestrain specimens made the seven-foot-tall guards look like beta male sissies.
Alex shuddered at the thought of their plans for Kaylee. Sweet Kaylee. Beautiful, pure, unspoiled Kaylee. His only hope. His only love.
He yelled, screamed, protested, gnashed his teeth, and begged as the soldiers carried her to the transport truck.
“What’s happening, Alex?” Kaylee cried.
Her lustrous blonde hair shone in the moonlight. Her beautiful white dress billowed. She was a captive angel, and they were smuggling her into Hades.
“Be strong, Kaylee!” Alex yelled.
“Rememba’. Ain’t nobody touch dis bitch ’til we git to da Chief’s palace,” Jamal yelled to his team. “No touchin’ her ’til Atlanta. Break dat rule and I’ll fuckin cap yo’ ass!”
“Awwww, why not, boss?” a soldier whined.
“Dis bitch a virgin,” Jamal said. “And ya’ll know how Darius X likes his virgins.”
“Alex! Get help!” Kaylee yelled.
“Stay strong,” Alex yelled over the mayhem. “I love you.”
“I love you, too,” Kaylee said, tears of horror falling from her eyes.
“I promise you, Kaylee-” Alex craned his neck, keeping eye contact as they threw her into the prisoner hold of the transport truck. “I’m coming for you! I swear to God, Kaylee! I’m coming for you!”
They slammed the door shut, and the soldiers kicked Alex’s little sissy body to the ground, laughing and smoking ganjala. The village sissies were still assembled in the village square, watching in terror as their precious lost vessel was locked away.
In the black of night, Kaylee’s face shone through a small round window in the back of the truck — no larger than a dinner plate. Alex wailed as the soldiers piled into their trucks and rode away.
“I’m coming for you!” Alex yelled again.
The beautiful blonde vision, framed in a small round halo of light inside the prisoner’s hold, grew smaller as it receded into the distance, down the mountain, headed for the heart of blackness.
№134607[Quote]
U
№134608[Quote]
test
№134609[Quote]
Wewrwe
№134610[Quote]
File: 6801481.png 📥︎ (26.32 KB, 197x251) 199819a4cb6c5b2c36569033a9976c9d658363491f53fb26da18867361ed7dd20ImgOps

play the tasty like a chocolate egg pony game and share your experiences here
№134611[Quote]
>>134610I like the grey pony, the one that is trapped
№134612[Quote]
>>134611>the one that is trappedmarge
№134613[Quote]
>>134612derpy whoves, I like the faces she makes at the start of the animation
№134615[Quote]
>>134610>>134611>>134612>>134613>>134614Why do you niggas want to baptize in the name of the Father, the Son and the Holy Spirit horses
№134616[Quote]
File: 1612778.png 📥︎ (1.47 MB, 1125x1500) 66b9d99ed1a19271325cdd5ad531863d2b9c33291da793b48a338a149e727b260ImgOps

>>134615meds theyre ponies not horses
№134617[Quote]
№134618[Quote]
Up
№134619[Quote]
>>134618i got the good ending
№134622[Quote]
>>134621THIS GAME IS holy!!!!!
№134623[Quote]
>>134610>>46076strobing jeff the killer swf dont click
№134625[Quote]
>>134624this game was one of my very first exposure to nsfw content, i hold fond memories of it today
thanks for sharing!
№134626[Quote]
##!!+==+!!##
№134628[Quote]
>>46109>>46108>>46107>>46106>>46105>>46104>>46110>>46111>>46112>>46113>>46114>>46115>>46116>>46117>>46118>>46119>>46120>>134626Obsessed Roman Award!
№134633[Quote]
>>134627>>134631I was edging for five hours and this made me explode! all over the place
№134634[Quote]
>>134631
literal screamer, you're warned

№134636[Quote]
File: 1333554.png 📥︎ (924.31 KB, 2708x2166) b0bce4c539c33d340e690d6a8d96da5f752872ddd8de8132a7818f844e137a6b0ImgOps

maaaaaaaaaaaaaaaaares
№134637[Quote]
!!TWIS IS BABAS BWORB >>>/CACA/ >>>/TRUMP/ !!
№134650[Quote]
Spring clean
№134651[Quote]
Spring cleaning
№134652[Quote]
Spring cleanerald
№134653[Quote]
Spring cleaners
№134655[Quote]
Up
№134656[Quote]
Spring clean test
№134657[Quote]
!!THE G00NERS WHERE ABLE 2 BVMP THEY'RE THREEADS AT 10 PM ADD THIS 2 THE WIKI NOW !!
№134658[Quote]
>>134657*were i mean doebeit
№134659[Quote]
>>134657Take your

no proof
№134660[Quote]
>>134659!!
YOU TAKE YOUR MEDS YOU DIRTY NIGGAR!!
№134662[Quote]
Spring
№134665[Quote]
XDEXDEXDGGXDG
№134667[Quote]
File: dead board.jpg 📥︎ (58.66 KB, 713x327) 285fdb802e50947bd438c63cb900d886db805fa0f18629d7c47fc47ba47f28ff0ImgOps

>0 pph
Nice board
№134668[Quote]
>pph with AGC
<0 pph
>pph with GO0N
<m0gs /s0y/ pph
Nice b0ard you got there g_eg!!
№134669[Quote]
X X X X X X Z D D D D D DD
№134671[Quote]
>>134670Isn't that what the whole war was about?
№134683[Quote]
Geeeeg
№134684[Quote]
!!I like sugar and i like tea but i don't like niggers no siree there's 2 known things that will make me puke that's a hog eating slop and a big black spook you know it cause i show it like a barnyard rooster i crow it and the n double a cp would sure like to get a hold of nigger hating. me roses are red and violets are blue and niggers are black you know that's true but they don't mind cause what the heck you gotta be black to get a welfare check and im broke no joke i aint gotta nickle for a coke and i aint black you see so uncle sam won't help poor nigger hating me. jig-a-boo jig-a-boo where are you? i was here in the wood pile watching you jig-a-boo jig-a-boo come out, naws im scared of the white man why down south you know it cause i show it stick your black head out and ill blow it and the n double a cp can't keep you away from little o nigger hating me. mirror mirror on the wall who is the blackest of them all? a man named king it aint no doubt and he's causing a lots of trouble with his baboon mouth arowit he's a doing it's caused by the trouble he's a brewing and the n double a cp can't win if a white man sticks with nigger hating me. hey mister president what do you say when are we whites gonna have our day? the niggers have there's such a long long time im white and it's time i have mine you know it cause i show it stick your black head out and ill blow it and the b double a cp can't win if a white man sticks with nigger hating me!!!
№134685[Quote]
!!I like sugar and i like tea but i don't like niggers no siree there's 2 known things that will make me puke that's a hog eating slop and a big black spook you know it cause i show it like a barnyard rooster i crow it and the n double a cp would sure like to get a hold of nigger hating. me roses are red and violets are blue and niggers are black you know that's true but they don't mind cause what the heck you gotta be black to get a welfare check and im broke no joke i aint gotta nickle for a coke and i aint black you see so uncle sam won't help poor nigger hating me. jig-a-boo jig-a-boo where are you? i was here in the wood pile watching you jig-a-boo jig-a-boo come out, naws im scared of the white man why down south you know it cause i show it stick your black head out and ill blow it and the n double a cp can't keep you away from little o nigger hating me. mirror mirror on the wall who is the blackest of them all? a man named king it aint no doubt and he's causing a lots of trouble with his baboon mouth arowit he's a doing it's caused by the trouble he's a brewing and the n double a cp can't win if a white man sticks with nigger hating me. hey mister president what do you say when are we whites gonna have our day? the niggers have there's such a long long time im white and it's time i have mine you know it cause i show it stick your black head out and ill blow it and the b double a cp can't win if a white man sticks with nigger hating me!!! Q
№134686[Quote]
!!I like sugar and i like tea but i don't like niggers no siree there's 2 known things that will make me puke that's a hog eating slop and a big black spook you know it cause i show it like a barnyard rooster i crow it and the n double a cp would sure like to get a hold of nigger hating. me roses are red and violets are blue and niggers are black you know that's true but they don't mind cause what the heck you gotta be black to get a welfare check and im broke no joke i aint gotta nickle for a coke and i aint black you see so uncle sam won't help poor nigger hating me. jig-a-boo jig-a-boo where are you? i was here in the wood pile watching you jig-a-boo jig-a-boo come out, naws im scared of the white man why down south you know it cause i show it stick your black head out and ill blow it and the n double a cp can't keep you away from little o nigger hating me. mirror mirror on the wall who is the blackest of them all? a man named king it aint no doubt and he's causing a lots of trouble with his baboon mouth arowit he's a doing it's caused by the trouble he's a brewing and the n double a cp can't win if a white man sticks with nigger hating me. hey mister president what do you say when are we whites gonna have our day? the niggers have there's such a long long time im white and it's time i have mine you know it cause i show it stick your black head out and ill blow it and the b double a cp can't win if a white man sticks with nigger hating me!!! Q Q
№134687[Quote]
!!I like sugar and i like tea but i don't like niggers no siree there's 2 known things that will make me puke that's a hog eating slop and a big black spook you know it cause i show it like a barnyard rooster i crow it and the n double a cp would sure like to get a hold of nigger hating. me roses are red and violets are blue and niggers are black you know that's true but they don't mind cause what the heck you gotta be black to get a welfare check and im broke no joke i aint gotta nickle for a coke and i aint black you see so uncle sam won't help poor nigger hating me. jig-a-boo jig-a-boo where are you? i was here in the wood pile watching you jig-a-boo jig-a-boo come out, naws im scared of the white man why down south you know it cause i show it stick your black head out and ill blow it and the n double a cp can't keep you away from little o nigger hating me. mirror mirror on the wall who is the blackest of them all? a man named king it aint no doubt and he's causing a lots of trouble with his baboon mouth arowit he's a doing it's caused by the trouble he's a brewing and the n double a cp can't win if a white man sticks with nigger hating me. hey mister president what do you say when are we whites gonna have our day? the niggers have there's such a long long time im white and it's time i have mine you know it cause i show it stick your black head out and ill blow it and the b double a cp can't win if a white man sticks with nigger hating me!!! Q Q Q
№134688[Quote]
!!I like sugar and i like tea but i don't like niggers no siree there's 2 known things that will make me puke that's a hog eating slop and a big black spook you know it cause i show it like a barnyard rooster i crow it and the n double a cp would sure like to get a hold of nigger hating. me roses are red and violets are blue and niggers are black you know that's true but they don't mind cause what the heck you gotta be black to get a welfare check and im broke no joke i aint gotta nickle for a coke and i aint black you see so uncle sam won't help poor nigger hating me. jig-a-boo jig-a-boo where are you? i was here in the wood pile watching you jig-a-boo jig-a-boo come out, naws im scared of the white man why down south you know it cause i show it stick your black head out and ill blow it and the n double a cp can't keep you away from little o nigger hating me. mirror mirror on the wall who is the blackest of them all? a man named king it aint no doubt and he's causing a lots of trouble with his baboon mouth arowit he's a doing it's caused by the trouble he's a brewing and the n double a cp can't win if a white man sticks with nigger hating me. hey mister president what do you say when are we whites gonna have our day? the niggers have there's such a long long time im white and it's time i have mine you know it cause i show it stick your black head out and ill blow it and the b double a cp can't win if a white man sticks with nigger hating me!!! Q Q Q Q
№134689[Quote]
!!I like sugar and i like tea but i don't like niggers no siree there's 2 known things that will make me puke that's a hog eating slop and a big black spook you know it cause i show it like a barnyard rooster i crow it and the n double a cp would sure like to get a hold of nigger hating. me roses are red and violets are blue and niggers are black you know that's true but they don't mind cause what the heck you gotta be black to get a welfare check and im broke no joke i aint gotta nickle for a coke and i aint black you see so uncle sam won't help poor nigger hating me. jig-a-boo jig-a-boo where are you? i was here in the wood pile watching you jig-a-boo jig-a-boo come out, naws im scared of the white man why down south you know it cause i show it stick your black head out and ill blow it and the n double a cp can't keep you away from little o nigger hating me. mirror mirror on the wall who is the blackest of them all? a man named king it aint no doubt and he's causing a lots of trouble with his baboon mouth arowit he's a doing it's caused by the trouble he's a brewing and the n double a cp can't win if a white man sticks with nigger hating me. hey mister president what do you say when are we whites gonna have our day? the niggers have there's such a long long time im white and it's time i have mine you know it cause i show it stick your black head out and ill blow it and the b double a cp can't win if a white man sticks with nigger hating me!!!
№134690[Quote]
!!I like sugar and i like tea but i don't like niggers no siree there's 2 known things that will make me puke that's a hog eating slop and a big black spook you know it cause i show it like a barnyard rooster i crow it and the n double a cp would sure like to get a hold of nigger hating. me roses are red and violets are blue and niggers are black you know that's true but they don't mind cause what the heck you gotta be black to get a welfare check and im broke no joke i aint gotta nickle for a coke and i aint black you see so uncle sam won't help poor nigger hating me. jig-a-boo jig-a-boo where are you? i was here in the wood pile watching you jig-a-boo jig-a-boo come out, naws im scared of the white man why down south you know it cause i show it stick your black head out and ill blow it and the n double a cp can't keep you away from little o nigger hating me. mirror mirror on the wall who is the blackest of them all? a man named king it aint no doubt and he's causing a lots of trouble with his baboon mouth arowit he's a doing it's caused by the trouble he's a brewing and the n double a cp can't win if a white man sticks with nigger hating me. hey mister president what do you say when are we whites gonna have our day? the niggers have there's such a long long time im white and it's time i have mine you know it cause i show it stick your black head out and ill blow it and the b double a cp can't win if a white man sticks with nigger hating me!!! Q
№134691[Quote]
!!I like sugar and i like tea but i don't like niggers no siree there's 2 known things that will make me puke that's a hog eating slop and a big black spook you know it cause i show it like a barnyard rooster i crow it and the n double a cp would sure like to get a hold of nigger hating. me roses are red and violets are blue and niggers are black you know that's true but they don't mind cause what the heck you gotta be black to get a welfare check and im broke no joke i aint gotta nickle for a coke and i aint black you see so uncle sam won't help poor nigger hating me. jig-a-boo jig-a-boo where are you? i was here in the wood pile watching you jig-a-boo jig-a-boo come out, naws im scared of the white man why down south you know it cause i show it stick your black head out and ill blow it and the n double a cp can't keep you away from little o nigger hating me. mirror mirror on the wall who is the blackest of them all? a man named king it aint no doubt and he's causing a lots of trouble with his baboon mouth arowit he's a doing it's caused by the trouble he's a brewing and the n double a cp can't win if a white man sticks with nigger hating me. hey mister president what do you say when are we whites gonna have our day? the niggers have there's such a long long time im white and it's time i have mine you know it cause i show it stick your black head out and ill blow it and the b double a cp can't win if a white man sticks with nigger hating me!!! Q Q
№134692[Quote]
!!I like sugar and i like tea but i don't like niggers no siree there's 2 known things that will make me puke that's a hog eating slop and a big black spook you know it cause i show it like a barnyard rooster i crow it and the n double a cp would sure like to get a hold of nigger hating. me roses are red and violets are blue and niggers are black you know that's true but they don't mind cause what the heck you gotta be black to get a welfare check and im broke no joke i aint gotta nickle for a coke and i aint black you see so uncle sam won't help poor nigger hating me. jig-a-boo jig-a-boo where are you? i was here in the wood pile watching you jig-a-boo jig-a-boo come out, naws im scared of the white man why down south you know it cause i show it stick your black head out and ill blow it and the n double a cp can't keep you away from little o nigger hating me. mirror mirror on the wall who is the blackest of them all? a man named king it aint no doubt and he's causing a lots of trouble with his baboon mouth arowit he's a doing it's caused by the trouble he's a brewing and the n double a cp can't win if a white man sticks with nigger hating me. hey mister president what do you say when are we whites gonna have our day? the niggers have there's such a long long time im white and it's time i have mine you know it cause i show it stick your black head out and ill blow it and the b double a cp can't win if a white man sticks with nigger hating me!!! Q Q Q
№134693[Quote]
!!I like sugar and i like tea but i don't like niggers no siree there's 2 known things that will make me puke that's a hog eating slop and a big black spook you know it cause i show it like a barnyard rooster i crow it and the n double a cp would sure like to get a hold of nigger hating. me roses are red and violets are blue and niggers are black you know that's true but they don't mind cause what the heck you gotta be black to get a welfare check and im broke no joke i aint gotta nickle for a coke and i aint black you see so uncle sam won't help poor nigger hating me. jig-a-boo jig-a-boo where are you? i was here in the wood pile watching you jig-a-boo jig-a-boo come out, naws im scared of the white man why down south you know it cause i show it stick your black head out and ill blow it and the n double a cp can't keep you away from little o nigger hating me. mirror mirror on the wall who is the blackest of them all? a man named king it aint no doubt and he's causing a lots of trouble with his baboon mouth arowit he's a doing it's caused by the trouble he's a brewing and the n double a cp can't win if a white man sticks with nigger hating me. hey mister president what do you say when are we whites gonna have our day? the niggers have there's such a long long time im white and it's time i have mine you know it cause i show it stick your black head out and ill blow it and the b double a cp can't win if a white man sticks with nigger hating me!!! Q Q Q Q
№134694[Quote]
!!I like sugar and i like tea but i don't like niggers no siree there's 2 known things that will make me puke that's a hog eating slop and a big black spook you know it cause i show it like a barnyard rooster i crow it and the n double a cp would sure like to get a hold of nigger hating. me roses are red and violets are blue and niggers are black you know that's true but they don't mind cause what the heck you gotta be black to get a welfare check and im broke no joke i aint gotta nickle for a coke and i aint black you see so uncle sam won't help poor nigger hating me. jig-a-boo jig-a-boo where are you? i was here in the wood pile watching you jig-a-boo jig-a-boo come out, naws im scared of the white man why down south you know it cause i show it stick your black head out and ill blow it and the n double a cp can't keep you away from little o nigger hating me. mirror mirror on the wall who is the blackest of them all? a man named king it aint no doubt and he's causing a lots of trouble with his baboon mouth arowit he's a doing it's caused by the trouble he's a brewing and the n double a cp can't win if a white man sticks with nigger hating me. hey mister president what do you say when are we whites gonna have our day? the niggers have there's such a long long time im white and it's time i have mine you know it cause i show it stick your black head out and ill blow it and the b double a cp can't win if a white man sticks with nigger hating me!!! Q Q Q Q
№134695[Quote]
!!I like sugar and i like tea but i don't like niggers no siree there's 2 known things that will make me puke that's a hog eating slop and a big black spook you know it cause i show it like a barnyard rooster i crow it and the n double a cp would sure like to get a hold of nigger hating me. roses are red and violets are blue and niggers are black you know that's true but they don't mind cause what the heck you gotta be black to get a welfare check and im broke no joke i aint gotta nickle for a coke and i aint black you see so uncle sam won't help poor nigger hating me. jig-a-boo jig-a-boo where are you? i was here in the wood pile watching you jig-a-boo jig-a-boo come out, naws im scared of the white man why down south you know it cause i show it stick your black head out and ill blow it and the n double a cp can't keep you away from little o nigger hating me. mirror mirror on the wall who is the blackest of them all? a man named king it aint no doubt and he's causing a lots of trouble with his baboon mouth arowit he's a doing it's caused by the trouble he's a brewing and the n double a cp can't win if a white man sticks with nigger hating me. hey mister president what do you say when are we whites gonna have our day? the niggers have there's such a long long time im white and it's time i have mine you know it cause i show it stick your black head out and ill blow it and the b double a cp can't win if a white man sticks with nigger hating me!!!
№134703[Quote]
B
№134704[Quote]
A
№134705[Quote]
I hope they ban you and delete nate kys EPI tranny
№134706[Quote]
Kys epi tranny
№134707[Quote]
I hope they ban you and delete nate kys EPI tranny
№134708[Quote]
Negated
№134709[Quote]
No
№134710[Quote]
No
№134711[Quote]
No
№134712[Quote]
Kys jartycuck
№134713[Quote]
No
№134714[Quote]
No
№134715[Quote]
No
№134716[Quote]
Nope
№134717[Quote]
Nope
№134718[Quote]
Kys
№134719[Quote]
Kys
№134720[Quote]
Kys
№134721[Quote]
No
№134722[Quote]
File: Oekaki.png 📥︎ (4.12 KB, 500x250) e3c14f8f11612c3c79221f450b85962d44d7a7c7980578fdee2ea0c79db8f2e10ImgOps

I hope they ban you and delete nate kys EPI tranny
№134723[Quote]
KYS
№134724[Quote]
Fail kys
№134725[Quote]
Kys
№134726[Quote]
Fuck you
№134727[Quote]
Fuck you tranny
№134730[Quote]
Kys epi tranny
№134746[Quote]
KYS
№134750[Quote]
KYS epi tranny
№134753[Quote]
.
№134754[Quote]
File: peace.jpg 📥︎ (415.85 KB, 1280x1262) e647f6c90c739f528c497bcf3463ec590133e5ae114372e711098d8ec61733790ImgOps

no
№134759[Quote]
DOWN
№134762[Quote]
>>134761thank you for adding to the list! that is also one of the things she is built for
№134764[Quote]
.
№134765[Quote]
.
№134766[Quote]
.
№134767[Quote]
.
№134768[Quote]
.
№134769[Quote]
.
№134770[Quote]
.
№134771[Quote]
.
№134772[Quote]
.
№134773[Quote]
.
№134774[Quote]
.
№134775[Quote]
.
№134776[Quote]
.
№134777[Quote]
.
№134778[Quote]
.
№134779[Quote]
.
№134780[Quote]
.
№134781[Quote]
.
№134782[Quote]
.
№134783[Quote]
.
№134784[Quote]
.
№134785[Quote]
№134786[Quote]
№134787[Quote]
№134788[Quote]
№134789[Quote]
№134790[Quote]
№134791[Quote]
№134792[Quote]
№134793[Quote]
№134794[Quote]
№134795[Quote]
№134796[Quote]
№134797[Quote]
№134798[Quote]
№134799[Quote]
№134800[Quote]
№134801[Quote]
№134802[Quote]
№134803[Quote]
№134804[Quote]
№134805[Quote]
№134806[Quote]
№134807[Quote]
№134808[Quote]
№134809[Quote]
.
№134810[Quote]
№134811[Quote]
№134812[Quote]
№134813[Quote]
№134816[Quote]
>>134813does this nigggaboo knows that the whole thread is still visible????
№134817[Quote]
.
№134822[Quote]
File: IMG_0096.jpeg 📥︎ (215.82 KB, 695x1024) 541c8b3191e574d6cb319c8ff6464f381843b36ec691f8bed3ed06433d70d1c40ImgOps

Always Strive For Enjoyment, But Not The Hedonistic Kind (gooning trooning drooging etc)
№134824[Quote]
File: IMG_0040.jpeg 📥︎ (77.49 KB, 821x1024) ff50f526a8411ad75760a774689159dba765752058984abde56465a159d29b5d0ImgOps

Please stop with the ‘totally ironic’ porn spam. You are the exact same as those trannies and child porn spammers, alongside jews and glowniggers that try and fail to divide and conquer. If all you do is deliberately get others to dislike you, then perhaps you should self reflect upon your own desires victimhood.
№134834[Quote]
ROOT DISAPPROVES OF
OF YOUR GOONING
№134837[Quote]
File: FMORFREE.jpg 📥︎ (1.9 KB, 64x64) cc8627b4d3544a5ac92cb12e34246ecdbf490b2d30c3fbfd4280ff4c2bfdcc900ImgOps

U AINT GETTING UR BOARD BACK
№134839[Quote]
^ Xhe's wrong you know
№134840[Quote]
test
№134841[Quote]
File: 018.jpg 📥︎ (514.52 KB, 1280x1810) 425ac07be2752b55a3756b110f7118f5c817e6233bb966071af563b8308e9bdc0ImgOps

>>134830at least post futa
№134844[Quote]
What was the get
№134846[Quote]
>>134845proof so I can add it to the 'ki please
№134847[Quote]
>>134846damn i forgot 2 screenshot
№134849[Quote]
>>134848errrrrrrrrrrrm how does that make u a woman?
№134854[Quote]
what happened to OP pic?
№134858[Quote]
test
№134859[Quote]
test
№134860[Quote]
erm mods can you remove the sticky. having a permanent thread is against the kulture
№134862[Quote]
>erm mods can you remove the sticky. having a permanent thread is against the kulture
cried to janny again award
№134863[Quote]
red text
№134864[Quote]
big red text test
№134865[Quote]
q
№134866[Quote]
q
№134867[Quote]
Baitfag is using a bot
№134868[Quote]
LMAO it realy is 1 cuck posting all this shit on the dead ass board 100%
№134869[Quote]
nine hundred thirty first
№134874[Quote]
File: nigga......PNG 📥︎ (2.89 KB, 487x98) 33332600ccc83332cccc33373b3fccddc4c833323332cccc3333cccdeefd33320ImgOps

it's been more than an hour nigger
№134875[Quote]
File: twth nwke.jpg 📥︎ (3.75 KB, 93x125) 6b060ef9d1a96f96fe3c64a39a991d4ea4db6ef84429e3541202b9e95c51abc20ImgOps

nine hundred and thirty ninth
№134877[Quote]
room
№134891[Quote]
>>134848>assuming people here goon to your crappy porn instead of just bumping it off the log The only things I enjoy are
medications, music, and books. Coomers are so retarded that they can't comprehend when someone comes on this board to spam for a few minutes.
№134895[Quote]
File: twth nwke.jpg 📥︎ (3.75 KB, 93x125) 6b060ef9d1a96f96fe3c64a39a991d4ea4db6ef84429e3541202b9e95c51abc20ImgOps

baby bQard
№134901[Quote]
File: nnnniggger.jpg 📥︎ (26.25 KB, 800x490) 199932dd39d83388399d976219f0d89789d8c9d29e9de98b06b8e907ccde63a40ImgOps

'cado
№134903[Quote]
File: nnnniggger.jpg 📥︎ (26.25 KB, 800x490) 199932dd39d83388399d976219f0d89789d8c9d29e9de98b06b8e907ccde63a40ImgOps

File: nnnniggger.jpg 📥︎ (26.25 KB, 800x490) 199932dd39d83388399d976219f0d89789d8c9d29e9de98b06b8e907ccde63a40ImgOps

File: nnnniggger.jpg 📥︎ (26.25 KB, 800x490) 199932dd39d83388399d976219f0d89789d8c9d29e9de98b06b8e907ccde63a40ImgOps

File: nnnniggger.jpg 📥︎ (26.25 KB, 800x490) 199932dd39d83388399d976219f0d89789d8c9d29e9de98b06b8e907ccde63a40ImgOps

add /cado/
№134905[Quote]
File: nnnniggger.jpg 📥︎ (26.25 KB, 800x490) 199932dd39d83388399d976219f0d89789d8c9d29e9de98b06b8e907ccde63a40ImgOps

File: nnnniggger.jpg 📥︎ (26.25 KB, 800x490) 199932dd39d83388399d976219f0d89789d8c9d29e9de98b06b8e907ccde63a40ImgOps

File: nnnniggger.jpg 📥︎ (26.25 KB, 800x490) 199932dd39d83388399d976219f0d89789d8c9d29e9de98b06b8e907ccde63a40ImgOps

add /cado/
№134906[Quote]
File: nnnniggger.jpg 📥︎ (26.25 KB, 800x490) 199932dd39d83388399d976219f0d89789d8c9d29e9de98b06b8e907ccde63a40ImgOps

File: nnnniggger.jpg 📥︎ (26.25 KB, 800x490) 199932dd39d83388399d976219f0d89789d8c9d29e9de98b06b8e907ccde63a40ImgOps

File: nnnniggger.jpg 📥︎ (26.25 KB, 800x490) 199932dd39d83388399d976219f0d89789d8c9d29e9de98b06b8e907ccde63a40ImgOps

File: nnnniggger.jpg 📥︎ (26.25 KB, 800x490) 199932dd39d83388399d976219f0d89789d8c9d29e9de98b06b8e907ccde63a40ImgOps

add /cado/
№134908[Quote]
File: nnnniggger.jpg 📥︎ (26.25 KB, 800x490) 199932dd39d83388399d976219f0d89789d8c9d29e9de98b06b8e907ccde63a40ImgOps

File: nnnniggger.jpg 📥︎ (26.25 KB, 800x490) 199932dd39d83388399d976219f0d89789d8c9d29e9de98b06b8e907ccde63a40ImgOps

File: nnnniggger.jpg 📥︎ (26.25 KB, 800x490) 199932dd39d83388399d976219f0d89789d8c9d29e9de98b06b8e907ccde63a40ImgOps

File: nnnniggger.jpg 📥︎ (26.25 KB, 800x490) 199932dd39d83388399d976219f0d89789d8c9d29e9de98b06b8e907ccde63a40ImgOps

add cado
№134910[Quote]
File: niggerhos.jpg 📥︎ (38.09 KB, 800x600) 723066a52a0e1547b3a891911b19b99b95184abdafdf702272354ef7ddcaaac50ImgOps

File: niggerhos.jpg 📥︎ (38.09 KB, 800x600) 723066a52a0e1547b3a891911b19b99b95184abdafdf702272354ef7ddcaaac50ImgOps

File: niggerhos.jpg 📥︎ (38.09 KB, 800x600) 723066a52a0e1547b3a891911b19b99b95184abdafdf702272354ef7ddcaaac50ImgOps

File: niggerhos.jpg 📥︎ (38.09 KB, 800x600) 723066a52a0e1547b3a891911b19b99b95184abdafdf702272354ef7ddcaaac50ImgOps

this is my board
№134912[Quote]
File: nnnniggger.jpg 📥︎ (26.25 KB, 800x490) 199932dd39d83388399d976219f0d89789d8c9d29e9de98b06b8e907ccde63a40ImgOps

File: nnnniggger.jpg 📥︎ (26.25 KB, 800x490) 199932dd39d83388399d976219f0d89789d8c9d29e9de98b06b8e907ccde63a40ImgOps

File: nnnniggger.jpg 📥︎ (26.25 KB, 800x490) 199932dd39d83388399d976219f0d89789d8c9d29e9de98b06b8e907ccde63a40ImgOps

add /cado/
№134914[Quote]
File: nnnniggger.jpg 📥︎ (26.25 KB, 800x490) 199932dd39d83388399d976219f0d89789d8c9d29e9de98b06b8e907ccde63a40ImgOps

File: nnnniggger.jpg 📥︎ (26.25 KB, 800x490) 199932dd39d83388399d976219f0d89789d8c9d29e9de98b06b8e907ccde63a40ImgOps

File: nnnniggger.jpg 📥︎ (26.25 KB, 800x490) 199932dd39d83388399d976219f0d89789d8c9d29e9de98b06b8e907ccde63a40ImgOps

File: nnnniggger.jpg 📥︎ (26.25 KB, 800x490) 199932dd39d83388399d976219f0d89789d8c9d29e9de98b06b8e907ccde63a40ImgOps

add /cado/
№134916[Quote]
File: niggerhos.jpg 📥︎ (38.09 KB, 800x600) 723066a52a0e1547b3a891911b19b99b95184abdafdf702272354ef7ddcaaac50ImgOps

File: niggerhos.jpg 📥︎ (38.09 KB, 800x600) 723066a52a0e1547b3a891911b19b99b95184abdafdf702272354ef7ddcaaac50ImgOps

File: niggerhos.jpg 📥︎ (38.09 KB, 800x600) 723066a52a0e1547b3a891911b19b99b95184abdafdf702272354ef7ddcaaac50ImgOps

File: niggerhos.jpg 📥︎ (38.09 KB, 800x600) 723066a52a0e1547b3a891911b19b99b95184abdafdf702272354ef7ddcaaac50ImgOps

oh yeah
№134917[Quote]
>>134916just 'ooned to this
also add /fur/
№134918[Quote]
File: niggerhos.jpg 📥︎ (38.09 KB, 800x600) 723066a52a0e1547b3a891911b19b99b95184abdafdf702272354ef7ddcaaac50ImgOps

File: nnnniggger.jpg 📥︎ (26.25 KB, 800x490) 199932dd39d83388399d976219f0d89789d8c9d29e9de98b06b8e907ccde63a40ImgOps

File: niggerhos.jpg 📥︎ (38.09 KB, 800x600) 723066a52a0e1547b3a891911b19b99b95184abdafdf702272354ef7ddcaaac50ImgOps

File: nnnniggger.jpg 📥︎ (26.25 KB, 800x490) 199932dd39d83388399d976219f0d89789d8c9d29e9de98b06b8e907ccde63a40ImgOps

let it burn into your retina
№134921[Quote]
File: nnnniggger.jpg 📥︎ (26.25 KB, 800x490) 199932dd39d83388399d976219f0d89789d8c9d29e9de98b06b8e907ccde63a40ImgOps

'cado
№134923[Quote]
File: nnnniggger.jpg 📥︎ (26.25 KB, 800x490) 199932dd39d83388399d976219f0d89789d8c9d29e9de98b06b8e907ccde63a40ImgOps

nick
№134925[Quote]
File: nnnniggger.jpg 📥︎ (26.25 KB, 800x490) 199932dd39d83388399d976219f0d89789d8c9d29e9de98b06b8e907ccde63a40ImgOps

File: niggerhos.jpg 📥︎ (38.09 KB, 800x600) 723066a52a0e1547b3a891911b19b99b95184abdafdf702272354ef7ddcaaac50ImgOps

'slot
№134927[Quote]
File: bigniggers.jpg 📥︎ (33.74 KB, 600x800) 66e6664886567ae4c9a105d69f9cb819c06c7ba83b87319e3b993ba7c072e6630ImgOps

can't handle me?
№134928[Quote]
File: nnnniggger.jpg 📥︎ (26.25 KB, 800x490) 199932dd39d83388399d976219f0d89789d8c9d29e9de98b06b8e907ccde63a40ImgOps

'cado
№134930[Quote]
File: niggerslot.jpg 📥︎ (34.13 KB, 800x600) c695fe22c2b2d633c9d2e33fcf98c519e5996e9f657d268664648cc7686814440ImgOps

its staring back
№134932[Quote]
File: niggerslot.jpg 📥︎ (34.13 KB, 800x600) c695fe22c2b2d633c9d2e33fcf98c519e5996e9f657d268664648cc7686814440ImgOps

File: niggerslot.jpg 📥︎ (34.13 KB, 800x600) c695fe22c2b2d633c9d2e33fcf98c519e5996e9f657d268664648cc7686814440ImgOps

File: niggerslot.jpg 📥︎ (34.13 KB, 800x600) c695fe22c2b2d633c9d2e33fcf98c519e5996e9f657d268664648cc7686814440ImgOps

File: niggerslot.jpg 📥︎ (34.13 KB, 800x600) c695fe22c2b2d633c9d2e33fcf98c519e5996e9f657d268664648cc7686814440ImgOps

№134934[Quote]
File: niggersock.jpg 📥︎ (34.76 KB, 800x600) cce7c6322672e43b222d9676f1663333998d18736399b8c91a79459e89e2f26c0ImgOps

File: niggersock.jpg 📥︎ (34.76 KB, 800x600) cce7c6322672e43b222d9676f1663333998d18736399b8c91a79459e89e2f26c0ImgOps

File: niggersock.jpg 📥︎ (34.76 KB, 800x600) cce7c6322672e43b222d9676f1663333998d18736399b8c91a79459e89e2f26c0ImgOps

fucka
№134936[Quote]
File: nnnniggger.jpg 📥︎ (26.25 KB, 800x490) 199932dd39d83388399d976219f0d89789d8c9d29e9de98b06b8e907ccde63a40ImgOps

HWABAG
№134940[Quote]
File: nnnniggger.jpg 📥︎ (26.25 KB, 800x490) 199932dd39d83388399d976219f0d89789d8c9d29e9de98b06b8e907ccde63a40ImgOps

File: niggerhos.jpg 📥︎ (38.09 KB, 800x600) 723066a52a0e1547b3a891911b19b99b95184abdafdf702272354ef7ddcaaac50ImgOps

imagine them crushing your head
№134942[Quote]
File: bigniggers.jpg 📥︎ (33.74 KB, 600x800) 66e6664886567ae4c9a105d69f9cb819c06c7ba83b87319e3b993ba7c072e6630ImgOps

riding the biebie sea
№134944[Quote]
File: niggerslot.jpg 📥︎ (34.13 KB, 800x600) c695fe22c2b2d633c9d2e33fcf98c519e5996e9f657d268664648cc7686814440ImgOps

add /cado/
№134946[Quote]
File: nnnniggger.jpg 📥︎ (26.25 KB, 800x490) 199932dd39d83388399d976219f0d89789d8c9d29e9de98b06b8e907ccde63a40ImgOps

add /cado/
№134949[Quote]
File: bigniggers.jpg 📥︎ (33.74 KB, 600x800) 66e6664886567ae4c9a105d69f9cb819c06c7ba83b87319e3b993ba7c072e6630ImgOps

File: niggersock.jpg 📥︎ (34.76 KB, 800x600) cce7c6322672e43b222d9676f1663333998d18736399b8c91a79459e89e2f26c0ImgOps

the one and only
№134951[Quote]
File: niggersock.jpg 📥︎ (34.76 KB, 800x600) cce7c6322672e43b222d9676f1663333998d18736399b8c91a79459e89e2f26c0ImgOps

№134954[Quote]
File: niggersock.jpg 📥︎ (34.76 KB, 800x600) cce7c6322672e43b222d9676f1663333998d18736399b8c91a79459e89e2f26c0ImgOps

№134956[Quote]
File: niggerslot.jpg 📥︎ (34.13 KB, 800x600) c695fe22c2b2d633c9d2e33fcf98c519e5996e9f657d268664648cc7686814440ImgOps

№134957[Quote]
File: niggersock.jpg 📥︎ (34.76 KB, 800x600) cce7c6322672e43b222d9676f1663333998d18736399b8c91a79459e89e2f26c0ImgOps

№134963[Quote]
File: hairy.jpg 📥︎ (37.53 KB, 600x800) c0efc4cb466566e78fd41f7437b83f7876393238303130397870d88fd9cc2c250ImgOps

File: hairy.jpg 📥︎ (37.53 KB, 600x800) c0efc4cb466566e78fd41f7437b83f7876393238303130397870d88fd9cc2c250ImgOps

№134965[Quote]
File: upview.jpg 📥︎ (37.89 KB, 600x800) 4083197308ecad78453d7696aa9fe2434366cca98565c6baeefce31243dbd3250ImgOps

File: hairy.jpg 📥︎ (37.53 KB, 600x800) c0efc4cb466566e78fd41f7437b83f7876393238303130397870d88fd9cc2c250ImgOps

File: niggersock.jpg 📥︎ (34.76 KB, 800x600) cce7c6322672e43b222d9676f1663333998d18736399b8c91a79459e89e2f26c0ImgOps

File: nnnniggger.jpg 📥︎ (26.25 KB, 800x490) 199932dd39d83388399d976219f0d89789d8c9d29e9de98b06b8e907ccde63a40ImgOps

№134967[Quote]
File: niggerslot.jpg 📥︎ (34.13 KB, 800x600) c695fe22c2b2d633c9d2e33fcf98c519e5996e9f657d268664648cc7686814440ImgOps

File: nnnniggger.jpg 📥︎ (26.25 KB, 800x490) 199932dd39d83388399d976219f0d89789d8c9d29e9de98b06b8e907ccde63a40ImgOps

№134971[Quote]
File: niggerhos.jpg 📥︎ (38.09 KB, 800x600) 723066a52a0e1547b3a891911b19b99b95184abdafdf702272354ef7ddcaaac50ImgOps

File: upview.jpg 📥︎ (37.89 KB, 600x800) 4083197308ecad78453d7696aa9fe2434366cca98565c6baeefce31243dbd3250ImgOps

№134973[Quote]
File: hairy.jpg 📥︎ (37.53 KB, 600x800) c0efc4cb466566e78fd41f7437b83f7876393238303130397870d88fd9cc2c250ImgOps

File: hairy.jpg 📥︎ (37.53 KB, 600x800) c0efc4cb466566e78fd41f7437b83f7876393238303130397870d88fd9cc2c250ImgOps

File: hairy.jpg 📥︎ (37.53 KB, 600x800) c0efc4cb466566e78fd41f7437b83f7876393238303130397870d88fd9cc2c250ImgOps

№134979[Quote]
File: hairy.jpg 📥︎ (37.53 KB, 600x800) c0efc4cb466566e78fd41f7437b83f7876393238303130397870d88fd9cc2c250ImgOps

File: niggersock.jpg 📥︎ (34.76 KB, 800x600) cce7c6322672e43b222d9676f1663333998d18736399b8c91a79459e89e2f26c0ImgOps

File: hairy.jpg 📥︎ (37.53 KB, 600x800) c0efc4cb466566e78fd41f7437b83f7876393238303130397870d88fd9cc2c250ImgOps

№134981[Quote]
File: hairy.jpg 📥︎ (37.53 KB, 600x800) c0efc4cb466566e78fd41f7437b83f7876393238303130397870d88fd9cc2c250ImgOps

№134985[Quote]
File: hairy.jpg 📥︎ (37.53 KB, 600x800) c0efc4cb466566e78fd41f7437b83f7876393238303130397870d88fd9cc2c250ImgOps

File: niggersock.jpg 📥︎ (34.76 KB, 800x600) cce7c6322672e43b222d9676f1663333998d18736399b8c91a79459e89e2f26c0ImgOps

File: niggerslot.jpg 📥︎ (34.13 KB, 800x600) c695fe22c2b2d633c9d2e33fcf98c519e5996e9f657d268664648cc7686814440ImgOps

bungholez
№134986[Quote]
File: niggersock.jpg 📥︎ (34.76 KB, 800x600) cce7c6322672e43b222d9676f1663333998d18736399b8c91a79459e89e2f26c0ImgOps

File: niggerslot.jpg 📥︎ (34.13 KB, 800x600) c695fe22c2b2d633c9d2e33fcf98c519e5996e9f657d268664648cc7686814440ImgOps

File: niggersock.jpg 📥︎ (34.76 KB, 800x600) cce7c6322672e43b222d9676f1663333998d18736399b8c91a79459e89e2f26c0ImgOps

№134987[Quote]
File: niggersock.jpg 📥︎ (34.76 KB, 800x600) cce7c6322672e43b222d9676f1663333998d18736399b8c91a79459e89e2f26c0ImgOps

№134988[Quote]
File: hairy.jpg 📥︎ (37.53 KB, 600x800) c0efc4cb466566e78fd41f7437b83f7876393238303130397870d88fd9cc2c250ImgOps

File: bigniggers.jpg 📥︎ (33.74 KB, 600x800) 66e6664886567ae4c9a105d69f9cb819c06c7ba83b87319e3b993ba7c072e6630ImgOps

№134990[Quote]
File: hairy.jpg 📥︎ (37.53 KB, 600x800) c0efc4cb466566e78fd41f7437b83f7876393238303130397870d88fd9cc2c250ImgOps

File: hairy.jpg 📥︎ (37.53 KB, 600x800) c0efc4cb466566e78fd41f7437b83f7876393238303130397870d88fd9cc2c250ImgOps

№134991[Quote]
File: hairy.jpg 📥︎ (37.53 KB, 600x800) c0efc4cb466566e78fd41f7437b83f7876393238303130397870d88fd9cc2c250ImgOps

File: upview.jpg 📥︎ (37.89 KB, 600x800) 4083197308ecad78453d7696aa9fe2434366cca98565c6baeefce31243dbd3250ImgOps

№134994[Quote]
File: nnnniggger.jpg 📥︎ (26.25 KB, 800x490) 199932dd39d83388399d976219f0d89789d8c9d29e9de98b06b8e907ccde63a40ImgOps

'cado
№134999[Quote]
File: hairy.jpg 📥︎ (37.53 KB, 600x800) c0efc4cb466566e78fd41f7437b83f7876393238303130397870d88fd9cc2c250ImgOps

File: niggersock.jpg 📥︎ (34.76 KB, 800x600) cce7c6322672e43b222d9676f1663333998d18736399b8c91a79459e89e2f26c0ImgOps

№135001[Quote]
File: niggersock.jpg 📥︎ (34.76 KB, 800x600) cce7c6322672e43b222d9676f1663333998d18736399b8c91a79459e89e2f26c0ImgOps

№135002[Quote]
File: niggersock.jpg 📥︎ (34.76 KB, 800x600) cce7c6322672e43b222d9676f1663333998d18736399b8c91a79459e89e2f26c0ImgOps

File: hairy.jpg 📥︎ (37.53 KB, 600x800) c0efc4cb466566e78fd41f7437b83f7876393238303130397870d88fd9cc2c250ImgOps

№135004[Quote]
File: upview.jpg 📥︎ (37.89 KB, 600x800) 4083197308ecad78453d7696aa9fe2434366cca98565c6baeefce31243dbd3250ImgOps

File: hairy.jpg 📥︎ (37.53 KB, 600x800) c0efc4cb466566e78fd41f7437b83f7876393238303130397870d88fd9cc2c250ImgOps

File: niggersock.jpg 📥︎ (34.76 KB, 800x600) cce7c6322672e43b222d9676f1663333998d18736399b8c91a79459e89e2f26c0ImgOps

№135005[Quote]
File: hairy.jpg 📥︎ (37.53 KB, 600x800) c0efc4cb466566e78fd41f7437b83f7876393238303130397870d88fd9cc2c250ImgOps

File: hairy.jpg 📥︎ (37.53 KB, 600x800) c0efc4cb466566e78fd41f7437b83f7876393238303130397870d88fd9cc2c250ImgOps

№135007[Quote]
File: niggerhos.jpg 📥︎ (38.09 KB, 800x600) 723066a52a0e1547b3a891911b19b99b95184abdafdf702272354ef7ddcaaac50ImgOps

№135011[Quote]
File: hairy.jpg 📥︎ (37.53 KB, 600x800) c0efc4cb466566e78fd41f7437b83f7876393238303130397870d88fd9cc2c250ImgOps

№135013[Quote]
File: upview.jpg 📥︎ (37.89 KB, 600x800) 4083197308ecad78453d7696aa9fe2434366cca98565c6baeefce31243dbd3250ImgOps

№135014[Quote]
destroy him 'cadoposter i can't stop gooning
№135016[Quote]
File: upview.jpg 📥︎ (37.89 KB, 600x800) 4083197308ecad78453d7696aa9fe2434366cca98565c6baeefce31243dbd3250ImgOps

File: hairy.jpg 📥︎ (37.53 KB, 600x800) c0efc4cb466566e78fd41f7437b83f7876393238303130397870d88fd9cc2c250ImgOps

File: niggersock.jpg 📥︎ (34.76 KB, 800x600) cce7c6322672e43b222d9676f1663333998d18736399b8c91a79459e89e2f26c0ImgOps

№135017[Quote]
File: niggersock.jpg 📥︎ (34.76 KB, 800x600) cce7c6322672e43b222d9676f1663333998d18736399b8c91a79459e89e2f26c0ImgOps

File: niggerslot.jpg 📥︎ (34.13 KB, 800x600) c695fe22c2b2d633c9d2e33fcf98c519e5996e9f657d268664648cc7686814440ImgOps

№135020[Quote]
File: untitled1.jpg 📥︎ (41.76 KB, 600x800) d94c22a7fc1d5d1726baabc816a57840a43aa3a72ad957a95680556a51f7f1d50ImgOps

File: untitled2.jpg 📥︎ (39.97 KB, 600x800) 270c223d31fc7c30b924e9b38f1edf8886c0d87998df34a15cc15cd2cc62dddd0ImgOps

File: untitled3.jpg 📥︎ (35.65 KB, 800x600) f66142a2e4734c44ccf3cceacce18459ffd9a04912b9f2a0115efff5880e1faa0ImgOps

File: untitled4.jpg 📥︎ (29.3 KB, 600x800) d86c49eea9933710528aa27d37734aa2a5e4dd226a9f8ddcd96a9a8a6ba532310ImgOps

№135021[Quote]
File: untitled5.jpg 📥︎ (34.01 KB, 800x600) b78f83e148605c77bc80cdc948c9dccbce0a8f7f4990f0ceb02fbd372b9017540ImgOps

File: untitled6.jpg 📥︎ (44.48 KB, 800x600) 785af9df2c823834a67e864bc6426534e4a616d970d97c669b99b2e783e2681d0ImgOps

File: untitled7.jpg 📥︎ (107.92 KB, 600x800) 38439949115c203c4e1e564b77c5d5bd4b932d9fd5b94b09bd23d0f34f28b7480ImgOps

File: untitled8.jpg 📥︎ (33.12 KB, 600x800) b87c38ac13804f814a93ea9bf47bbd79b17896a89aa482afd7036bd64856554b0ImgOps

№135022[Quote]
File: untitled9.jpg 📥︎ (35.96 KB, 600x800) 53d176666e73e26634d9972dd928bec68cf491c7b41819831b7c2593e103e6710ImgOps

File: untitled10.jpg 📥︎ (43.98 KB, 600x800) f6292693a62327692a2ffc69c0f5d0471fc3a1145098ebb70f81e3abd85e96690ImgOps

File: untitled11.jpg 📥︎ (42.01 KB, 600x800) 6a3bb137b3b11b22bb0eaa3f817cf3b1fff5ea15456a4578cea0489540a209330ImgOps

File: untitled12.jpg 📥︎ (40.14 KB, 600x800) 64369a5a4b811d2df35fe4f23c70d75b58e708bc065e34c3e039596ed5928e910ImgOps

№135024[Quote]
File: untitled1.jpg 📥︎ (41.76 KB, 600x800) d94c22a7fc1d5d1726baabc816a57840a43aa3a72ad957a95680556a51f7f1d50ImgOps

File: untitled2.jpg 📥︎ (39.97 KB, 600x800) 270c223d31fc7c30b924e9b38f1edf8886c0d87998df34a15cc15cd2cc62dddd0ImgOps

File: untitled3.jpg 📥︎ (35.65 KB, 800x600) f66142a2e4734c44ccf3cceacce18459ffd9a04912b9f2a0115efff5880e1faa0ImgOps

File: untitled4.jpg 📥︎ (29.3 KB, 600x800) d86c49eea9933710528aa27d37734aa2a5e4dd226a9f8ddcd96a9a8a6ba532310ImgOps

№135025[Quote]
File: untitled5.jpg 📥︎ (34.01 KB, 800x600) b78f83e148605c77bc80cdc948c9dccbce0a8f7f4990f0ceb02fbd372b9017540ImgOps

File: untitled6.jpg 📥︎ (44.48 KB, 800x600) 785af9df2c823834a67e864bc6426534e4a616d970d97c669b99b2e783e2681d0ImgOps

File: untitled7.jpg 📥︎ (107.92 KB, 600x800) 38439949115c203c4e1e564b77c5d5bd4b932d9fd5b94b09bd23d0f34f28b7480ImgOps

File: untitled8.jpg 📥︎ (33.12 KB, 600x800) b87c38ac13804f814a93ea9bf47bbd79b17896a89aa482afd7036bd64856554b0ImgOps

№135026[Quote]
File: untitled9.jpg 📥︎ (35.96 KB, 600x800) 53d176666e73e26634d9972dd928bec68cf491c7b41819831b7c2593e103e6710ImgOps

File: untitled10.jpg 📥︎ (43.98 KB, 600x800) f6292693a62327692a2ffc69c0f5d0471fc3a1145098ebb70f81e3abd85e96690ImgOps

File: untitled11.jpg 📥︎ (42.01 KB, 600x800) 6a3bb137b3b11b22bb0eaa3f817cf3b1fff5ea15456a4578cea0489540a209330ImgOps

File: untitled12.jpg 📥︎ (40.14 KB, 600x800) 64369a5a4b811d2df35fe4f23c70d75b58e708bc065e34c3e039596ed5928e910ImgOps

№135031[Quote]
File: Oekaki.png 📥︎ (13.74 KB, 500x250) 6726c999f37363898cd9666cd9a69c99678c99668c99679932638ca6639936190ImgOps

a
№135033[Quote]
File: hairy.jpg 📥︎ (40 KB, 600x800) c0efc4cb466566e78fd41f7437b83f7876393238303130397870d88fd9cc2c250ImgOps

cope
№135045[Quote]
File: niggersock.jpg 📥︎ (36.99 KB, 800x600) cce7c6322676e43b222c9676f1663333998d18736399b8c91a79459e89e2f26c0ImgOps

№135047[Quote]
>>135046>>135046Fallout
One of the more notorious effects of tolerance to sexual stimuli happens when a male porn addict finds himself in a real-world sexual situation. The allure of a normal sexual partner barely registers a libidinous response, leading to what has been termed PIED: porn-induced erectile dysfunction. Having a sexual encounter fizzle due to PIED can be a tragic experience, especially for young men and teenagers who are just beginning to familiarize themselves with the sexual dimensions of their lives and identities. The numbers of young men experiencing erectile dysfunction would have been unthinkable in decades past before the Internet made porn so widely available. Studies show between a 600% and 3000% increase in erectile dysfunction among young men since the emergence of Internet pornography.
№135049[Quote]
File: hairy.jpg 📥︎ (40 KB, 600x800) c0efc4cb466566e78fd41f7437b83f7876393238303130397870d88fd9cc2c250ImgOps

File: niggersock.jpg 📥︎ (36.99 KB, 800x600) cce7c6322676e43b222c9676f1663333998d18736399b8c91a79459e89e2f26c0ImgOps

№135051[Quote]
File: untitled5.jpg 📥︎ (36.2 KB, 800x600) b78f83e148605c77bc80cdc948c9dccbce0a8f7f4990f0ceb02fbd372b9017540ImgOps

File: untitled5.jpg 📥︎ (36.2 KB, 800x600) b78f83e148605c77bc80cdc948c9dccbce0a8f7f4990f0ceb02fbd372b9017540ImgOps

File: untitled5.jpg 📥︎ (36.2 KB, 800x600) b78f83e148605c77bc80cdc948c9dccbce0a8f7f4990f0ceb02fbd372b9017540ImgOps

File: untitled5.jpg 📥︎ (36.2 KB, 800x600) b78f83e148605c77bc80cdc948c9dccbce0a8f7f4990f0ceb02fbd372b9017540ImgOps

№135057[Quote]
File: Oekaki.png 📥︎ (2.7 KB, 500x250) 00001134000011342c4b00002c4b1134000000002c4b2c4b00002c4b8200554b0ImgOps

niggers
№135059[Quote]
niggers
№135060[Quote]
niggers
№135061[Quote]
niggers
№135062[Quote]
niggers
№135063[Quote]
niggers
№135064[Quote]
niggers
№135065[Quote]
niggers
№135066[Quote]
niggers q
№135067[Quote]
niggers
№135068[Quote]
niggers q
№135069[Quote]
niggers
№135070[Quote]
spics
№135071[Quote]
niggers
№135072[Quote]
faggots
№135073[Quote]
niggers
№135074[Quote]
faggots
№135076[Quote]
faggots
№135077[Quote]
niggers
№135079[Quote]
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
№135080[Quote]
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
spics
№135081[Quote]
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
№135082[Quote]
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
faggots
№135083[Quote]
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
№135084[Quote]
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
faggots
№135085[Quote]
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
№135086[Quote]
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
faggots
№135087[Quote]
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
№135088[Quote]
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
faggots
№135089[Quote]
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
№135090[Quote]
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
faggots
№135091[Quote]
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
№135092[Quote]
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
faggots
№135093[Quote]
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
nbiggers
№135094[Quote]
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
faggots
№135095[Quote]
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
№135096[Quote]
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
faggots
№135097[Quote]
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
№135098[Quote]
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
faggots
№135099[Quote]
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
№135100[Quote]
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
faggots
№135101[Quote]
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
№135102[Quote]
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
faggots
№135103[Quote]
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
№135104[Quote]
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
faggots
№135105[Quote]
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
№135106[Quote]
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
faggots
№135107[Quote]
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
№135108[Quote]
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
faggots
№135109[Quote]
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
№135110[Quote]
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
faggots
№135111[Quote]
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
№135112[Quote]
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
faggots
№135113[Quote]
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
№135114[Quote]
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
faggots
№135115[Quote]
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
№135116[Quote]
wasted your life on spamming niggers award
№135117[Quote]
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
faggots
№135118[Quote]
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
№135119[Quote]
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
faggots
№135120[Quote]
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
№135121[Quote]
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
faggots
№135122[Quote]
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
niggers
№135125[Quote]
File: niggersock.jpg 📥︎ (37 KB, 800x600) cce7c6322676e43b222c9676f1663333998d18736399b8c91a79459e89e2f26c0ImgOps

№135126[Quote]
File: untitled5.jpg 📥︎ (36.21 KB, 800x600) b78f83e148605c77bc80cdc948c9dccbce0a8f7f4990f0ceb02fbd372b9017540ImgOps

№135127[Quote]
File: nnnniggger.jpg 📥︎ (27.71 KB, 800x490) 199932dd39d83388399d976219f0d89789d8c9d29e9de98b06b8e907ccde63a40ImgOps

№135131[Quote]
/fur/ status: ##desisted##
№135132[Quote]
gga
№135134[Quote]
File: FACT.png 📥︎ (108.66 KB, 775x1232) de7866979c5c412cb0dd3d604f21d1c03c334f1c4282a5e53c2dbbc35693b9fe0ImgOps

froot won
№135144[Quote]
cia psyop ev&oe
>>>/caca/ won
№135145[Quote]
WIG
№135154[Quote]
File: babymutt.jpg 📥︎ (3.61 KB, 134x129) eb86f09303d984710e1eb6f11e394de9f02c3ad9bcc01a5f874e74976b60caa50ImgOps

ameiba nuber 1
№135156[Quote]
File: twth nwke.jpg 📥︎ (3.75 KB, 93x125) 6b060ef9d1a96f96fe3c64a39a991d4ea4db6ef84429e3541202b9e95c51abc20ImgOps

baba nuber 1 cookie dough
№135163[Quote]
File: jarty (4).png 📥︎ (58.8 KB, 800x765) 0f08838776e24819bf26f2e70b18bf27d0c12f5ed72642f93f5a54a6005cff8a0ImgOps

>gooning
№135184[Quote]
.
№135188[Quote]
File: untitled5.jpg 📥︎ (36.21 KB, 800x600) b78f83e148605c77bc80cdc948c9dccbce0a8f7f4990f0ceb02fbd372b9017540ImgOps

niggers tongue my anus tongue my anus
niggers tongue my anus tongue my anus
niggers tongue my anus tongue my anus
niggers tongue my anus tongue my anus
niggers tongue my anus tongue my anus
niggers tongue my anus tongue my anus
niggers tongue my anus tongue my anus
niggers tongue my anus tongue my anus
niggers tongue my anus tongue my anus
niggers tongue my anus tongue my anus
niggers tongue my anus tongue my anus
niggers tongue my anus tongue my anus
niggers tongue my anus tongue my anus
niggers tongue my anus tongue my anus
niggers tongue my anus tongue my anus
niggers tongue my anus tongue my anus
niggers tongue my anus tongue my anus
niggers tongue my anus tongue my anus
niggers tongue my anus tongue my anus
niggers tongue my anus tongue my anus
niggers tongue my anus tongue my anus
niggers tongue my anus tongue my anus
niggers tongue my anus tongue my anus
niggers tongue my anus tongue my anus
niggers tongue my anus tongue my anus
niggers tongue my anus tongue my anus
niggers tongue my anus tongue my anus
niggers tongue my anus tongue my anus
niggers tongue my anus tongue my anus
niggers tongue my anus tongue my anus
niggers tongue my anus tongue my anus
niggers tongue my anus tongue my anus
niggers tongue my anus tongue my anus
niggers tongue my anus tongue my anus
niggers tongue my anus tongue my anus
niggers tongue my anus tongue my anus
niggers tongue my anus tongue my anus
niggers tongue my anus tongue my anus
niggers tongue my anus tongue my anus
niggers tongue my anus tongue my anus
№135194[Quote]
File: IMG_0181.jpeg 📥︎ (1.04 MB, 712x868) ddb7cce64cb34fdc3c890efd28823ccc724da3998e6cdc718f4bb0351f1844820ImgOps

№135195[Quote]
nigga
№135196[Quote]
File: twth nwke.jpg 📥︎ (3.75 KB, 93x125) 6b060ef9d1a96f96fe3c64a39a991d4ea4db6ef84429e3541202b9e95c51abc20ImgOps

##!!I like sugar and i like tea but i don't like niggers no siree, there's 2 known things that will make me puke that's a hog eating slop and a big black spook, you know it cause i show it like a barnyard rooster i crow it, and the n double a cp would sure like to get a hold of nigger hating me. roses are red and violets are blue and niggers are black, you know that's true but they don't mind cause what the heck, you gotta be black to get a welfare check and im broke no joke i aint gotta nickle for a coke and i aint black you see so uncle sam won't help poor nigger hating me. jig-a-boo jig-a-boo where are you? “i was here in the wood pile watching you” jig-a-boo jig-a-boo come out. "naws im scared of the white man way down south.” you know it cause i show it stick your black head out and i’ll blow it, and the n double a cp can't keep you away from little o nigger hating me. mirror mirror on the wall who is the blackest of them all? "a man named king it aint no doubt and he's causing a lots of trouble with his baboon mouth" arowit he's a doing it's caused by the trouble he's a brewing, and the n double a cp can't win if a white man sticks with nigger hating me. hey mister president what do you say when are we whites gonna have our day? the niggers have there's such a long long time im white and it's time that i have mine, you know it cause i show it stick your black head out and i’ll blow it and the n double a cp can't win if a white man sticks with nigger hating me!!!##
№135197[Quote]
.
№135198[Quote]
post rubbery soytan gems here!
№135199[Quote]
File: nnnniggger.jpg 📥︎ (27.71 KB, 800x490) 199932dd39d83388399d976219f0d89789d8c9d29e9de98b06b8e907ccde63a40ImgOps

>gooners
<the indomitable human spirit
№135202[Quote]
.
№135204[Quote]
>>135203Based and zekrom pilled
№135206[Quote]
50
№135209[Quote]
1-1 if that matters
>>>/caca/6616
№135212[Quote]
root board doe
№135218[Quote]
ROOT FUCKING WON
№135221[Quote]
Wt
№135226[Quote]
Roor
№135232[Quote]
erm
№135234[Quote]
root
№135236[Quote]
Root
№135238[Quote]
File: nnnniggger.jpg 📥︎ (27.71 KB, 800x490) 199932dd39d83388399d976219f0d89789d8c9d29e9de98b06b8e907ccde63a40ImgOps

i think he likes u ;)
№135242[Quote]
Wt
№135244[Quote]
Wt
№135246[Quote]
Wt
№135249[Quote]
Wt
№135252[Quote]
Wt
№135253[Quote]
File: niggersock.jpg 📥︎ (37 KB, 800x600) cce7c6322676e43b222c9676f1663333998d18736399b8c91a79459e89e2f26c0ImgOps

Oh my god she is so attractive :3
№135254[Quote]
Wt
№135256[Quote]
Root
№135259[Quote]
Root
№135261[Quote]
Root
№135263[Quote]
Root
№135266[Quote]
Root
№135268[Quote]
Root
№135270[Quote]
Root
№135273[Quote]
File: niggersock.jpg 📥︎ (37 KB, 800x600) cce7c6322676e43b222c9676f1663333998d18736399b8c91a79459e89e2f26c0ImgOps

never goon
№135274[Quote]
>>135273gooning to this rn
№135276[Quote]
Wt
№135278[Quote]
Wt
№135280[Quote]
Wt
№135282[Quote]
Wt
№135284[Quote]
Wt
№135286[Quote]
Wt
№135289[Quote]
Wt
№135291[Quote]
Wt
№135293[Quote]
Wt
№135295[Quote]
Root won
№135297[Quote]
Root won
№135307[Quote]
>>134420mods ban this guy
№135308[Quote]
>>135307erm i forgot 2 say why i wanted that guy banned it's cause it's an after party bot or whoever from 3 or 2 months ago
№135310[Quote]
PINGAS WON
№135313[Quote]
>>135312Not reading allat
№135322[Quote]
>>135320Thanks, I was looking for the original video for a while.
№135325[Quote]
File: sdsdf.PNG 📥︎ (112.76 KB, 1374x972) 0de2f302924e13f8fa0ef98107f021fcfd0ffd841e1702f84e79c1c907fb04fc0ImgOps

the front page of nigger on google won
№135327[Quote]
>>135326Gooning to this rn
№135329[Quote]
File: cado (1).jpg 📥︎ (37.79 KB, 800x600) a0b11f2b8074fe2b8770e83b0fd0c939df8ac159dc8e0df9ccae6e6126ee74400ImgOps

cado
№135332[Quote]
File: slo.gif 📥︎ (810.59 KB, 929x780) 7251f1526e5312e331bc6dae90e65d990ImgOps

File: slo.gif 📥︎ (810.59 KB, 929x780) 7251f1526e5312e331bc6dae90e65d990ImgOps

##☺☹☻☠⚕️⚕️⚕️⚕️⚕️⚕️⚕️⚕️⚕️⚕️⚕️⚕️⚖⚖⚖⚖⚖⚖⚖⚖⚖⚖⚖⚖✈️✈️✈️✈️✈️✈️✈️✈️✈️✈️✈️✈️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️️♂️♂️♂️♂️♂️♂️️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️❤️❤️❤️❤️☝️☝☝☝☝☝✌✌✌✌✌✌✋✋✋✋✋✋✊✊✊✊✊✊✍✍✍✍✍✍❤❣⛑⚘☘☕✨⚽️⚾️⛳️♂️♂️♂️♂️♂️♂️️♀️♀️♀️♀️♀️♀️⛸⛷♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️⛹️♂️⛹♂️⛹♂️⛹♂️⛹♂️⛹♂️⛹️♀️⛹♀️⛹♀️⛹♀️⛹♀️⛹♀️️♂️♂️♂️♂️♂️♂️️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️♠️♥️♦️♣️⛰⛪⛩⛲⛺⛼♨️⛟⛽⚓⛵♂️♂️♂️♂️♂️♂️♀️♀️♀️♀️♀️♀️⛴✈⌛⏳⌚⏰⏱⏲☀️⭐☁️⛅⛈☂️☔⛱⚡❄☃️⛄☄☎️⌨✉✏✒✂️⛏⚒⚔⚙⚗⚖⛓⚰⚱♿⚠️⛔☢☣⬆️↗️➡️↘️⬇️↙️⬅️↖️↕️↔️↩↪⤴️⤵️⚛✡☸☯️☦☮♈♉♊♋♌♍♎♏♐♑♒♓⛎▶️⏩⏭⏯◀️⏪⏮⏫⏬⏸⏹⏺⏏♻️⚜⭕✅☑✔✖❌❎➕♀️♂️⚕➖➗➰➿〽️✳✴❇⁉️❓❔❕❗〰️️️️️️️ℹ️Ⓜ️️️️️️️️️️️️️️️️️️️️️️㊗️㊙️️️▫️◻◼◽◾⬛⬜️️️️️⚪⚫️⚀⚁⚂⚃⚄⚅⛾♾##
№135335[Quote]
FPE
№135338[Quote]
File: yup.gif 📥︎ (771.16 KB, 264x400) 742e7c23497becb63e7b4fe489368d4b0ImgOps

holy fail raid, baba won
№135339[Quote]
vm1
№135342[Quote]
Vm1
№135348[Quote]
>
№135350[Quote]
DOLL WON
soygem lost
jakparty lost
'cord niggers lost
kvz lost
/fap/ lost
christ won
>>>/caca/ won
I WON
№135351[Quote]
File: yup.gif 📥︎ (771.16 KB, 264x400) 742e7c23497becb63e7b4fe489368d4b0ImgOps

File: twth nwke.jpg 📥︎ (3.75 KB, 93x125) 6b060ef9d1a96f96fe3c64a39a991d4ea4db6ef84429e3541202b9e95c51abc20ImgOps

>>135350errrm fix the thing where the images don't post
№135352[Quote]
>>
№135353[Quote]
>>
№135356[Quote]
ed
№135357[Quote]
File: yup.gif 📥︎ (771.16 KB, 264x400) 742e7c23497becb63e7b4fe489368d4b0ImgOps

!!NEW DOLLIST ORDER!!
!!PERMA ALL ANTI-DOLLISTS NOW!!
№135358[Quote]
>
№135359[Quote]
File: twth nwke.jpg 📥︎ (3.75 KB, 93x125) 6b060ef9d1a96f96fe3c64a39a991d4ea4db6ef84429e3541202b9e95c51abc20ImgOps

File: yup.gif 📥︎ (771.16 KB, 264x400) 742e7c23497becb63e7b4fe489368d4b0ImgOps

!!DADA WON!!
№135360[Quote]
>>
№135361[Quote]
>>135355Are the hands holding xer white or is it just ai generated? Fail.
№135364[Quote]
File: a.gif 📥︎ (172.6 KB, 783x822) 591ec5e4e6acb7c00a80e08109444aa20ImgOps

NEVER GOON
№135366[Quote]
File: hwabag (20).png 📥︎ (160.37 KB, 359x500) c6bcc292617c09cb48f426a2bba1e9fe227b33645ebac49fb50e319670d538c50ImgOps

!!hitler board!!
№135368[Quote]
>>null
DOWN THE MINE
№135369[Quote]
>>null
BIRDS ARE SINGIN
№135370[Quote]
>>null
KAPOWIE
№135371[Quote]
>>null
DON'T TOUCH MY CANARY
№135372[Quote]
>>null
WHO WANTS SOME TNT
№135373[Quote]
>>null
DYNO-MITE!
№135375[Quote]
>>null
DYNO-MITE!
№135376[Quote]
File: hwabag (4).png 📥︎ (631.22 KB, 651x491) 5bd5bf3a43d0aea431019460af4ac097f7390847821fe9e3163e7cf161e5e78a0ImgOps

File: hwabag (1).jpg 📥︎ (77.71 KB, 676x900) 6ac19a5c73c50c1d45cc2c9de9661941e5344de3663329d6771392decc89eead0ImgOps

File: hwabag (10).png 📥︎ (668.25 KB, 1138x833) 3df1cdd27b9b9f94bcec759ceb82ad3461a407ac3a46a23505444f238c3d29650ImgOps

File: hwabag (16).png 📥︎ (1.39 MB, 1050x1500) 261a439e4461a356118f2e5940fb7d439bb1f58ea5f511f8db0b02bb345cdee40ImgOps

hitler board
№135377[Quote]
6
№135378[Quote]
File: hwabag (5).png 📥︎ (594.6 KB, 636x487) ad21175a59c4fed07361fd8e9fcc3c21fec0d9afd00e3febe0310053018e270f0ImgOps

hitler board doughie doe
№135379[Quote]
Lee
№135381[Quote]
>>135380poorly photoshopped
original was white
№135382[Quote]
>>135367yeah how bout you dynajump in the middle of the road old man
№135383[Quote]
File: jarty (35).png 📥︎ (394.34 KB, 1073x1082) 8ce2c32c719c08d3ac6bd73c43d33c4bb434c3b40f4b3c6bf2f4c382280f3cfd0ImgOps

>>hitler board doughie doe
№135385[Quote]
sisa
№135386[Quote]
File: fnf (3).png 📥︎ (133.26 KB, 802x660) 6a2f91b146999df16b8bf46a2fd1fe24cd907e0de091cc89d11a7e0781ea6a520ImgOps

whiter than you or something
№135388[Quote]
File: jarty (4).png 📥︎ (58.8 KB, 800x765) 0f08838776e24819bf26f2e70b18bf27d0c12f5ed72642f93f5a54a6005cff8a0ImgOps

^^ leak ing sarby ccacacac
№135389[Quote]
> or something
№135390[Quote]
File: hwabag (1).png 📥︎ (631.22 KB, 651x491) 5bd5bf3a43d0aea431019460af4ac097f7390847821fe9e3163e7cf161e5e78a0ImgOps

ronald won
or something
№135391[Quote]
File: hwabag (10).jpg 📥︎ (57.24 KB, 567x638) 2c85586ddb6a310116b7d667a94da3eccd03512b22b58e949cdcb1595f3bcb1a0ImgOps

rape me ronald mcdonald
№135392[Quote]
^ or something
№135394[Quote]
>
№135395[Quote]
File: taiwan flag.jpg 📥︎ (6.61 KB, 300x199) 21b101b9e3fec3c4c3c393931e3e1c643de139e1e03ecc1cfe1ebe3e33c341c00ImgOps

taiwan won
№135396[Quote]
>
№135400[Quote]
File: 8.mp4 📥︎ (10.39 MB, 450x360) 99db1ff176bd0ca98e9d47088f4af15d0ImgOps

you don't get it guys serbia won or something among them lines
№135404[Quote]
File: 6.mp4 📥︎ (6.68 MB, 480x360) 478fb96744a6689103711c804bc65a390ImgOps

errm you don't get it guys republika srpska won o algo
№135408[Quote]
File: 6.mp4 📥︎ (6.68 MB, 480x360) 478fb96744a6689103711c804bc65a390ImgOps

the serbs are white lol
<the captcha was incorrect
№135409[Quote]
>
№135411[Quote]
File: 36634.jpg 📥︎ (1.01 MB, 1980x2800) ab825f8071d3b3ee4b0e270570519ce09f3071c39f4f4d34b6de679835c479620ImgOps

№135412[Quote]
File: vyfhv33.png 📥︎ (728.67 KB, 1396x2048) e6d925a9b35092197c64635e5b09b47c0e292b38aad435adf47116b33b9ccbc60ImgOps

sexy mares won
№135413[Quote]
File: Lennon.png 📥︎ (27.04 KB, 600x800) 3cc64a4cb3cd0b2ccb3d3d212d7cf0a5950d03dc503d3f308bf0f0b37f520f5a0ImgOps

HWABAG
№135414[Quote]
File: Lennon.png 📥︎ (27.04 KB, 600x800) 3cc64a4cb3cd0b2ccb3d3d212d7cf0a5950d03dc503d3f308bf0f0b37f520f5a0ImgOps

.
№135415[Quote]
File: Lennon.png 📥︎ (27.04 KB, 600x800) 3cc64a4cb3cd0b2ccb3d3d212d7cf0a5950d03dc503d3f308bf0f0b37f520f5a0ImgOps

.
№135419[Quote]
.
№135420[Quote]
.
№135421[Quote]
,
№135422[Quote]
.
№135423[Quote]
>>1354221488th reply to this thread
№135426[Quote]
#test#
№135427[Quote]
#test#
№135428[Quote]
File: nate.png 📥︎ (1.01 MB, 900x900) 70fc8dd3f2ff034d8220c349dfcefbed030c0f3c091cacb0fcf396f02027e80d0ImgOps

>nate
№135430[Quote]
File: 11.mp4 📥︎ (3.1 MB, 640x360) d6d22e56364e4849210fac257c3ef3010ImgOps

serbian board
№135431[Quote]
File: 1.MP4 📥︎ (4.99 MB, 176x144) 10ea3af7b70605561af3a9669e0877440ImgOps

preserved
№135432[Quote]
>>135431Needed /soy/ for that award
№135435[Quote]
File: 7.mp4 📥︎ (15.12 MB, 640x360) a2e22e83265f1ef3c4b9efab07c970860ImgOps

'nother win o algo
even doe GETS don't really matter
№135437[Quote]
Xhe will never be your wife. Xhe will never exist. Xhe will never hold your hard. Xhe will never have sex with you. You will never touch xer. Xhe is a bunch of pixels on a screen of different colors next to each other. Xhe would never have sex with your small pecker. You will never feel xer touch. You will never have a real wife. You will never feel her breathing on your neck. You will never be able yo hug xer. Wake up to reality.
№135438[Quote]
falsenvke
№135441[Quote]
>
№135444[Quote]
love how dead this board is
№135446[Quote]
new rule:
if the first page consists of porn more than 25%, YOU VILL DO A CATTYWIPE
№135448[Quote]
>>135445>>135447most obsessed faggot award
№135450[Quote]
File: 1715187732451r.jpg 📥︎ (34.11 KB, 474x632) 7927727427b561b65e3ba634e599c46e85c08d8c9cc89d8f7ef0f24bb24132310.9675155878067ImgOps

>>135449*sits on your lap*
№135452[Quote]
File: ClipboardImage.png 📥︎ (93.12 KB, 400x237) 3339a4f136c032667332d619c649e761df661b66cb330cb63db6e584aba8c2a90.0013936809264123ImgOps

Ass cum nigga
№135454[Quote]
Groupwipe 9/4/24 we won
№135458[Quote]
File: MYWIFESISA.png 📥︎ (187.41 KB, 467x425) 307a48b9d96001e731e6ff93871d069bc050b32b1f5dc4ccf87077f92ab4f0560.10710328072309ImgOps

I'll let you wipe just because you helped me

№135459[Quote]
Niggers
№135460[Quote]
File: jartycuck.jpg 📥︎ (243.59 KB, 1920x1798) 9d79a5e715f584e0baa4d4e1b5ecbde2154077e4eac0fdc4ffea42a40005856a0.02924226410687ImgOps

№135465[Quote]
File: ClipboardImage.png 📥︎ (93.57 KB, 505x332) f83c0f0941e187c9f0e11ff8fc171f0e01f8e1fcc3d41f1ef8031ce31c13f0730.017366483807564ImgOps

File: ClipboardImage.png 📥︎ (2.7 KB, 441x75) 2e4e27ce038efd8bd1d1f831b81507f606765e8f07f9f009f81503f0a815dc2f0.00020068627782166ImgOps

File: ClipboardImage.png 📥︎ (8.31 KB, 431x80) 667e722df00cac06efa7ffb09dd00fde0aef036d8045e401eea1b02111547fde6.7714136093855E-6ImgOps

File: MYWIFESISA.png 📥︎ (200.31 KB, 467x425) 307a48b9d96001e731e6ff93871d069bc050b32b1f5dc4ccf87077f92ab4f0560.10710328072309ImgOps

№135466[Quote]
File: 1725968756937.jpg 📥︎ (43.11 KB, 800x600) 0f94d1e1ff0789d4803ed78a35f1de1c3e8380583071fe7cff43555041d4ae270.0038175212685019ImgOps

*sharts on your post*
№135467[Quote]
File: ClipboardImage.png 📥︎ (57.02 KB, 143x255) 0cead2673ad4f934e801b4f1e94ba7bb5293000c8a47f484fadaef53a553558b0.37253773212433ImgOps

№135468[Quote]
File: ClipboardImage.png 📥︎ (1.1 MB, 1254x690) 4db4057ccaa29764caeba2a84dfb90b541f5957ce8a1557fc89512eaa95592aa2.9789177915518E-6ImgOps

just rape this board already
№135470[Quote]
File: 1622913.png 📥︎ (797.56 KB, 1280x957) 0fe361e6d9e21f31bc1ffe218783ef9e707c55e100b1e27ae34e01c7c085c1870.28433352708817ImgOps

№135471[Quote]
1499
№135472[Quote]
1500 rape all gooners
№135473[Quote]
>
№135476[Quote]
O
№135477[Quote]
i hate niggers
№135480[Quote]
>>135479 errm yea i am :3
№135481[Quote]
File: FwroQ3fXwAAECXC.jpg 📥︎ (501.9 KB, 3034x2696) 5ef688ef7e4b1ccf3233c4716b307f32b33403ada951fbe240c8b2bdd40127120.99268847703934ImgOps

№135483[Quote]
>
№135484[Quote]
File: image.png 📥︎ (78.56 KB, 983x936) 46acde46b19b93b4cb7921b037875e3ab720e30ee06667a998dc19f21d8b8c5c0.12000166624784ImgOps

File: image.png 📥︎ (137.39 KB, 1560x1242) 9c46666d311214edc9d835988b939b34c2eb3a7434ef0e789966cd9b6d90b1a70.38744813203812ImgOps

>this is still nates board, but you can dump your porn in this thread if you want
№135486[Quote]
.
№135526[Quote]
>
№135531[Quote]
File: cadosuit.png 📥︎ (264.61 KB, 386x565) ad27d69ed5ac6b61296bb844941dddecd664949bb29c690463de729475216a700.013104677200317ImgOps

№135532[Quote]
>
№135534[Quote]
.
№135535[Quote]
File: IMG_1272.png 📥︎ (5.88 KB, 370x303) 1f2d4269a52d6e964ac2bf1b80d42360fc4bd0b413cebe99f4670ddc67335e0c0.80597484111786ImgOps

File: IMG_1273.png 📥︎ (6.22 KB, 370x303) 1b864a69a52d0e965a63af1ba5d623717c4b50b496cabe91d0660dfc67d3568c0.83584630489349ImgOps

>>135484>o-obsessed cumstone o- oh algo~ №135536[Quote]
File: anu-min.png 📥︎ (1.62 MB, 2158x1708) f2b6757b6ab3c08615ce0bfbe8b3b736539372304ea54c875c1c8e58c958990a0.059734702110291ImgOps

Total gooner death
№135538[Quote]
File: NEVER_GOON (1).png 📥︎ (1.24 MB, 1024x1024) 5f992836bc43a5b255b6ef838a5b6c1344f3f23cbfc5008355d4c3289aad58750.26477316021919ImgOps

Never goon won
№135539[Quote]
>
№135540[Quote]
File: NEVER_GOON (1).png 📥︎ (1.24 MB, 1024x1024) 5f992836bc43a5b255b6ef838a5b6c1344f3f23cbfc5008355d4c3289aad58750.26477316021919ImgOps

Never goon
№135542[Quote]
File: NEVER_GOON (1).png 📥︎ (1.24 MB, 1024x1024) 5f992836bc43a5b255b6ef838a5b6c1344f3f23cbfc5008355d4c3289aad58750.26477316021919ImgOps

Never goon won
№135543[Quote]
>
№135544[Quote]
File: IMG_1595.jpeg 📥︎ (251.95 KB, 1421x2048) a253d758592593a50ab66d5659cf38e12c9f661f973493d264694ce549b4939c0.89667195081711ImgOps

File: IMG_1596.jpeg 📥︎ (160.33 KB, 2048x1421) 23b3cb5cb8cac8d1dd6ec8c6365de4c81b2dccd6bc3863d534cc321dc31991b20.99832981824875ImgOps

File: IMG_1597.jpeg 📥︎ (161.9 KB, 2048x1421) 2aa7db1cb8cec8d1dd66c8c6365de4ca1b2dcec69c3863dd34c8309dc31991b20.99439805746078ImgOps

№135545[Quote]
File: IMG_1467.png 📥︎ (578.83 KB, 2000x2000) e36e686222e00f3da25fca93b9a01d984a1fd01f3c897fe0672624bbd89d73650.05528163164854ImgOps

File: IMG_1468.jpeg 📥︎ (844.91 KB, 2072x1960) 278b221b3219f689b3468364c6366e714d686da63c3749669bcfd8d2f0e9269d0.050741981714964ImgOps

File: IMG_1470.png 📥︎ (132.51 KB, 635x1080) 8ebd516cf5e1b2d45746e2a542f267e304275ed33af8902d968dd083a15e893e0.0019244289724156ImgOps

File: IMG_1471.png 📥︎ (320.98 KB, 1651x2476) d727884ed7e7c606837d1f29285979f8228525c6f2c6d097073b2f525a1fe0ac0.14403426647186ImgOps

№135546[Quote]
As an average teenager, each night I do the same routine: eat dinner, study, chill and then finally bust a nut before I go to sleep (I tend to have an easier time sleeping after orgasms). I'm 17 years old and have been masturbating daily since I was 12 years old. As you might expect, I need more than just porn to bust a good nut. I've been using various sex toys such as flesh-lights, and it's not just limited to that. I have also secretly bought live-size Japanese sex dolls. From all these years of mastering the art of watching porn without being caught by my parents, I was capable of ordering very large toys without my parents knowing. I'd have it shipped to my friend's house while his parents were at work, then I would pick it up from his house and use it inside my closet. Today in particular, I grew tired of the Japanese sex doll. I wanted something that can create an ultra-realistic sexual experience that will cause me to bust the most satisfying, high volume nut in history. I browsed TikTok sellers for some ideas. After several hours of searching, I came across a particularly interesting item: the George Floyd toy. Just by looking at it, I got a massive boner. I even almost came in my pants without touching it. At that moment, I knew this would be the perfect sex toy. I copped the doll and then excitedly waited the 20 days it takes to deliver. Fast-forward to the day it came in the mail. My mom came into my room with the package. "Honey, you have a parcel. What did you purchase?" she asked. I knew exactly how to explain it. "That is my new George Floyd plush, I bought it to honour his death and to support the cause." I explained. She bought into it and handed me the toy. Holy raisin! I immediately got the urge to rub its face all over my dick. I Googled the original George Floyd video and then pulled down my pants and started rubbing it out on the George Floyd toy's face. After 10 seconds, I busted my biggest nut yet. It shot out white liquid at a distance of 2 metres. George Floyd toy's face was painted all white. Man that was the best feeling ever! I went to the washroom to clean the toy. I valued it so much so I stored it in my closet and then went to bed. When I woke up, I couldn't wait to bust a bonus nut before I go to school, but when I opened my closet, my George Floyd toy didn't look like itself at all. Its outer fabric appeared to have a large hole. I chalked it as my semen being acidic and went in with my day. Once I returned from school I saw my mom, she was dead. I couldn't believe my eyes, so I went over to investigate. There I saw a bullet hole through her pregnant belly. I cried a lot, because I lost my mom and my future brother. I needed to get my revenge on whoever murdered them. I searched around the house for the robber. I couldn't find any weapon to use to defend myself against a gunman, so I decided to use a book that I could use for blocking bullets. I went upstairs. At first I didn't see anything in the second story hallway, but I heard a small voice. I looked down. There I saw it, a very miniature person. When I looked closely, I saw it was a miniature George Floyd, except some features were altered: the George Floyd mini-me had tentacles for arms and only had 1 eye. I freaked out so much from the organism that I used my book to crush it. "Lift up the book please, I can't breath." it said. I just kept the book on it until I stopped hearing it breath. I did some research on how this George Floyd homunculus existed. There were a ton of rumours spreading through the internet that the George Floyd toy contains an egg which was extracted from George Floyd's corpse. Always be careful for what you decide to bust a nut in; you never know what lifeforms you can create.
№135549[Quote]
>>135547erm xher name is clyde get it right chudcel
№135550[Quote]
File: Oekaki.png 📥︎ (2.71 KB, 500x250) 00001134000011342c4b00002c4b1134000000002c4b2c4b00002c4b8200554b0.014106441289186ImgOps

Never goon
№135551[Quote]
File: 1714994883166t.jpg 📥︎ (79.01 KB, 716x716) 70e11ae130ba1d97729ef1b69b64262f6d61b968845b4d830f299cd65e8b67290.010984471067786ImgOps

Never goon
№135552[Quote]
>
№135553[Quote]
File: 1711552612214v.png 📥︎ (1.23 MB, 1024x1024) 4ecf406996a57316f76b10f71b34c0623c8578eb37d65ca7c75a879a70848a690.015183372423053ImgOps

Never goon
№135554[Quote]
>
№135555[Quote]
File: 1728123186741j.jpg 📥︎ (45.39 KB, 600x800) 160d823db07cfc30d930f937cfde0f8892d0e079381fb4a12d015ec2ece6d9dd0.24725562334061ImgOps

You will never be a real porn board. You have no threads, you have no gifs, you have no webms. You are a dead personal cord channel twisted by cattywipes and one samefag into a cruel mockery of 4cuck's red boards.
All the "posts" you get is same-fagged and contrived. Behind your back everyone posts on other boards. Gooners are ashamed of you, widownigger cries at your desolate appearance, while samefagging all day on xis public cord server.
Gooners are utterly repulsed by you. Thousands of hours of gooning has allowed them to sweat and brap and coom to established websites. Even porn posted in the sticky is hidden behind 9000 cados and TND clips. Even if you get a drunk man into your threads, he'll turn tail and bolt the second he gets a whiff of your empty page 2 and diseased, rotten sticky.
Widownigger, you will never be happy. You wretch out a fake smile every single morning to post fresh threads then patrol /nate/ every 15 minutes to negate cattywipes, but deep inside you feel depression creeping up like 50 threads, ready to slide you off the catty.
Eventually, it'll be too much to bear - you'll get kicked out of your basement, lose your internet, and be tossed into the outside world. Your parents will be heartbroken, but relieved that you won't be spending your entire life playing sisyphus on a dead nigger of a board. Your threads will be buried without a headstone, your presence will be eliminated. Every soyteen for the rest of the eternity will skip /nate/. Your threads will turn to dust, no one will goon to them, and all that will remain is a hidden, empty board that no one will even lurk.
№135556[Quote]
File: MYWIFESISA.png 📥︎ (187.41 KB, 467x425) 307a48b9d96001e731e6ff93871d069bc050b32b1f5dc4ccf87077f92ab4f0560.10710328072309ImgOps

File: Blover.png 📥︎ (657.17 KB, 676x1021) fe549bc6c3605f06d0004fa84ea3fc3c8167be8e5075b1c03f1ef85e43ead7110.54421854019165ImgOps

>>135555Skibidi dop dop dop yes yes yes
№135557[Quote]
File: 1728534155240f.jpeg 📥︎ (169.66 KB, 1024x1024) e2992da2207fc499de869a958a78294e68c9c4b0afb42cb9545a57d32e8bedcd0.20398491621017ImgOps

Never goon
№135558[Quote]
File: 1720456148726.png 📥︎ (778.99 KB, 1080x1147) a713a7db85345b9a5ca6e6932273229cd30c1d38c45a0c3df2cb7bacb9b8d2430.012080850079656ImgOps

AGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGUAGUGU
№135559[Quote]
e
№135560[Quote]
test dfsadfasfasdf
№135561[Quote]
nnnn
№135562[Quote]
uhh
№135564[Quote]
File: ClipboardImage.png 📥︎ (401.99 KB, 951x834) 1d8ce34cb5a90dbc65997698c6d8629b394cbd69c753c73c48b4b5e6ba042a530.27476319670677ImgOps

№135565[Quote]
File: 1724516288588v.jpg 📥︎ (164.89 KB, 1024x1024) 5ec4c6d6ec967278db386869b7a6986a4c6d178091967a9e5a7865faa71c8a240.015853336080909ImgOps

NHalloweenvHalloweenr goon my niggHalloweenr
№135566[Quote]
>
№135567[Quote]
File: 1724516288588v.jpg 📥︎ (164.89 KB, 1024x1024) 5ec4c6d6ec967278db386869b7a6986a4c6d178091967a9e5a7865faa71c8a240.015853336080909ImgOps

>NHalloweenvHalloweenr goon my niggHalloweenr
№135568[Quote]
>
№135569[Quote]
File: ClipboardImage.png 📥︎ (26.81 KB, 898x185) ff80ff00e0fa00fe107781fe93243f05079d05dd7c0bf0f0fae0fe0283f801fd0.00074521038914099ImgOps

Snca
№135572[Quote]
>
№135573[Quote]
>>135558You will hang, pedophile
№135574[Quote]
File: 6012310.png 📥︎ (1.18 MB, 1080x1629) 5a13405955eb5341736ec72bd53895b345f1cd278946994eacd9a8b5ab6363a40.179ImgOps

>>>111791
>Die
№135575[Quote]
File: IMG_0603.jpeg 📥︎ (60.76 KB, 1125x1125) 1ad72dc2748b62dd6508669d6dd845ab6595b16293b1b64692cbccb7931e46590.061ImgOps

Trvmp won
№135576[Quote]
>
№135630[Quote]
Geg sorry jannjan
№135631[Quote]
^^^ brownest nigger faggot dyke kike coon porch monkey ever award
№135732[Quote]
Muh
№135782[Quote]
nuke newyork
№135784[Quote]
File: himmler (25).jpg 📥︎ (83.61 KB, 611x900) 49cb6ca5e33cb4b61cd14b406724b23f8cfb73cb4d301790cc6cb26fac3d432c0.001ImgOps

skibidi
№135786[Quote]
trvke above
№135788[Quote]
>
№135790[Quote]
>
№135799[Quote]
№135807[Quote]
№135813[Quote]
№135814[Quote]
№135817[Quote]
>
№135818[Quote]
did you know that this is nates board, thanks.
№135819[Quote]
>
№135824[Quote]
,
№135825[Quote]
im going to live myself today
№135827[Quote]
elf…
№135828[Quote]
Mexico is Germanic
Mexico is White
Mexico is the homeland of the White Race.
copy and paste this message into 20 breads to show your love for the aryan motherland
№135829[Quote]
>
№135830[Quote]
Mexico is Germanic
Mexico is White
Mexico is the homeland of the White Race.
copy and paste this message into 20 breads to show your love for the aryan motherland
№135831[Quote]
Love from Bharat ❤️
№135832[Quote]
kys
№135833[Quote]
bump!
№135847[Quote]
>
№135849[Quote]
>
№135850[Quote]
Mexico is Germanic
Mexico is White
Mexico is the homeland of the White Race.
copy and paste this message into 20 breads to show your love for the aryan motherland
№135852[Quote]
Mexico is Germanic
Mexico is White
Mexico is the homeland of the White Race.
copy and paste this message into 20 breads to show your love for the aryan motherland
№135854[Quote]
>
№135855[Quote]
bumping a sticky
№135856[Quote]
bumping a sticky 1
№135857[Quote]
bumping a sticky
№135858[Quote]
bumping a sticky
№135859[Quote]
bumpimg a sticky
№135860[Quote]
i'm bumping a sticky
№135861[Quote]
tje body
№135862[Quote]
op
№135863[Quote]
kill your local nigger
№135864[Quote]
test
№135865[Quote]
got me goin ski buh dee ski buh dee
№135866[Quote]
jarty fail
№135867[Quote]
upperino
№135868[Quote]
sex
№135869[Quote]
up
№135870[Quote]
nigger
№135871[Quote]
negro children
№135872[Quote]
kill nigger
№135873[Quote]
transltae
№135874[Quote]
nigger
№135875[Quote]
negro child
№135876[Quote]
>
№135877[Quote]
>
<
^
№135878[Quote]
nigger people
№135879[Quote]
enslave a nigger
№135880[Quote]
use a nigger as a walking big black booty
№135881[Quote]
lick niggers' asses
№135882[Quote]
up
№135883[Quote]
big black booty made for big white cock
№135884[Quote]
nigger
№135885[Quote]
niggers were made to please the white race
№135886[Quote]
.
№135887[Quote]
up
№135888[Quote]
kek
№135889[Quote]
sl
№135890[Quote]
up
№135891[Quote]
bumo
№135892[Quote]
.
№135893[Quote]
up
№135894[Quote]
.
№135895[Quote]
op
№135896[Quote]
nig
№135897[Quote]
,
№135898[Quote]
.,.
№135899[Quote]
.
№135900[Quote]
kkmmn
№135901[Quote]
,km
№135902[Quote]
km;
№135903[Quote]
'/
№135904[Quote]
m lniobhyigi;n
№135905[Quote]
[
№135906[Quote]
,lm l;'
№135909[Quote]
>
№135910[Quote]
#ra#
№135911[Quote]
##ra##
№135912[Quote]
>
№135913[Quote]
Mexico is Germanic
Mexico is White
Mexico is the homeland of the White Race.
copy and paste this message into 20 breads to show your love for the aryan motherland
№135918[Quote]
File: never goon.png 📥︎ (1.01 MB, 1024x1024) ad1964d2b5721d1c50f66b1fd271f0d085a6b56d4a69ca2d68e954f08a5eada60.021ImgOps

№135919[Quote]
>
№135921[Quote]
File: mp4.mp4 📥︎ (3.96 MB, 632x812) c7ef53f9d53b461db1801ba575cbe57d0.08ImgOps

№135923[Quote]
supersaging a sticky!!!
№135926[Quote]
>
№135928[Quote]
Mexico is Germanic
Mexico is White
Mexico is the homeland of the White Race.
copy and paste this message into 20 breads to show your love for the aryan motherland
№135932[Quote]
>
№135934[Quote]
>
№135936[Quote]
>
№135938[Quote]
>
№135940[Quote]
>
№135942[Quote]
File: Heresrapeson.jpg 📥︎ (97.08 KB, 600x638) 9a6727638ccb924c9c66a49bcd996663e0c16266272d9f2c3cc670e6f8d8cf380.043ImgOps

narge
№135946[Quote]
Kill yourself faggot
№135947[Quote]
>
№135950[Quote]
>
№135951[Quote]
>>135949marge this is not gooning
№135954[Quote]
>
№135958[Quote]
>
№135960[Quote]
>
№135962[Quote]
goon nigger
№135963[Quote]
>
№135965[Quote]
>>135964raisinskin gooner
№135966[Quote]
>
№135968[Quote]
>
№135969[Quote]
never goon
№135970[Quote]
never goon
move this post with an arrow if youre a proud gooner
№135971[Quote]
>supersaging a sticky!
№135973[Quote]
>>>176098
>
>>>176074(You)
>>>173934(You)
>>>176098(You)
>>>173911(You)
>>>173897(You)
>>>173896(You)
>>>173474(You)
>>>173370(You)
>>>172813(You)
№135974[Quote]
never goon
move this post with an arrow if youre a proud gooner
№135978[Quote]
sage
№135981[Quote]
sage
№136000[Quote]
File: 104AShot067.png 📥︎ (371.51 KB, 1366x768) 6c8c8c733380880c672b29f3df3e27c8a771f88a5a3727f9ddcec033ae40fd040.07ImgOps

fury won B)
№136007[Quote]
File: Spadeson.png 📥︎ (38.38 KB, 415x900) de5e2f347b11258179f1bc91c2d4fc2c0fc6506dbf0852b2dc29aa9145af5d4a0.017ImgOps

№136011[Quote]
File: BBC Addict.png 📥︎ (57.32 KB, 410x522) 1b70dbdc267339bccce4735b468cb8e4c31b7264859f7e7061069c69e186365c0.013ImgOps

№136013[Quote]
File: Spadeson.png 📥︎ (38.38 KB, 415x900) de5e2f347b11258179f1bc91c2d4fc2c0fc6506dbf0852b2dc29aa9145af5d4a0.017ImgOps

№136016[Quote]
File: Spadeson.png 📥︎ (38.38 KB, 415x900) de5e2f347b11258179f1bc91c2d4fc2c0fc6506dbf0852b2dc29aa9145af5d4a0.017ImgOps

№136018[Quote]
File: Spadeson.png 📥︎ (38.38 KB, 415x900) de5e2f347b11258179f1bc91c2d4fc2c0fc6506dbf0852b2dc29aa9145af5d4a0.017ImgOps

№136021[Quote]
File: paperborea.png 📥︎ (1.53 MB, 1200x903) cc32367960c0ecd90eb9c629e0d70dce328e062ebc99b3344ecbf860e7cbccd60.35ImgOps

File: paperborea2.png 📥︎ (1.58 MB, 1200x903) d93674a57dc6a4bd0d2cb62181d71fcab29e032aea91f3744c0a5960d78bdc960.65ImgOps

№136022[Quote]
>>136021Miss Circle will never be real
№136023[Quote]
File: Truth Nuke.png 📥︎ (266.37 KB, 768x719) f1be5821d8465c4a0488fefdf1ab01b9e65ef64081bc3f0ee702e3eb1f01e11e0.013ImgOps

№136030[Quote]
File: BBC Addict.png 📥︎ (57.32 KB, 410x522) 1b70dbdc267339bccce4735b468cb8e4c31b7264859f7e7061069c69e186365c0.014ImgOps

№136033[Quote]
File: Wiferald.jpg 📥︎ (27.92 KB, 364x405) e0595f7ce83c4a5d6d8c682b70ba6a433f0d07744167b15f5c9607e0256bf60b0.396ImgOps

№136035[Quote]
raisin
test
№136037[Quote]
File: images8.jpg 📥︎ (20.83 KB, 349x489) 4a777b71e39207b99f2405d3d5262cb5c7d287c3e85343b1af53e41242f078740.827ImgOps

She is good and does not have to be treated weirdly.
№136040[Quote]
File: rockwell (3).jpg 📥︎ (Spoiler Image, 55.95 KB, 612x402) f6f774164c4f682f335a17f01ccd651a9b6fd863049e2e8f19e59974a0d298050ImgOps

brown niggers from lesotho above
№136041[Quote]
>>134046 (OP)Nuclear brap of a board
№136043[Quote]
^ iranian
№136044[Quote]
broken nigger of a website
№136046[Quote]
brown negro pedophile demonrat above me
№136048[Quote]
https://files.catbox.moe/qd4fpg.rarSHARK.RAR #1 IS UPLOADED
Archived threads from 29th of March to 4th of april
№136057[Quote]
File: neutral.png 📥︎ (97.87 KB, 600x800) c34cf2e80f3735aa8a3913963cf3f34f4c72c3cd34320b4db4c78d3cd39150d40.005ImgOps

>>136056Brony children should be aborted.
№136059[Quote]
File: soykneel 2.png 📥︎ (318.87 KB, 454x698) 41a59e63d91e3c52cc2432cd4ef6c9533483edb8b34cb4ddce745bccdc1101370.031ImgOps

PATER NOSTER, qui es in caelis, sanctificetur nomen tuum.
Adveniat regnum tuum. Fiat voluntas tua, sicut in caelo et in terra.
Panem nostrum quotidianum da nobis hodie, et dimitte nobis debita nostra sicut et nos dimittimus debitoribus nostris.
Et ne nos inducas in tentationem, sed libera nos a malo.
Amen.
№136063[Quote]
14Nate_Higgers88
№136079[Quote]
Results of the "Favorite /nate/ kinos" poll, in case the thread dies:
Sharks - 9
Salem/gayposting - 7
Yiff - 7
Other - 5
FPE - 4
Ponies - 3
Widowmaker - 2
Terrible mouse - 2
The thread was multiple choice
№136080[Quote]
File: gigamonk.png 📥︎ (54.31 KB, 255x224) cb6d24aca6d87b692424cad3d56b29a4929b756bc8b6d51a9933d17645682ec90.015ImgOps

Credo in unum Deum, Patrem omnipotentem,
factorem caeli et terrae, visibilium omnium et
invisibilium.
Et in unum Dominum lesum Cristum, Filium
Dei unigenitum, et ex Patre natum ante omnia
saecula.
Deum de Deo, Lumen de Lumine, Deum
verum de Deo vero, genitum non factum.
consubstantialem Patri; per quem omnia facta
sunt.
Cuius regni non erit finis.
Et in Spiritum Sanctum, Dominum et
vivificantem, qui ex Patre Filio que procedit.
Qui cum Patre et Filio simul adoratur et
conglorificatur:
qui locutus est per prophetas.
Amen.
№136109[Quote]
>>136108Amen indeed mon ami
№136112[Quote]
cs
№136113[Quote]
What's this board? Why is the banned Cleveland jr
№136117[Quote]
Clearly, you do not own an airfryer
№136119[Quote]
>>136118Geeeeeeeeeg what a gay nigger worshipping pedo cult
№136122[Quote]
File: 335.jpg 📥︎ (369.92 KB, 1064x1600) 3cbb97f3e9a98b430ea5b54cd8961656d97ae2e801740cab2644df83ed032a760ImgOps

can this thread be the refuge for nsfw boards like /gif/ and /hc/ since it's stickied?